\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130714423:

Variant ID: vg0130714423 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30714423
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGCAGGGATGCATGTCAAAATTCAGCTCCCTTTTCACCCCTTTCTACTACTAATTCCGTGTAACTTAGTATTATTCGTGGGCTCAAGACCTCCAAAA[G/A]
GCAAATTGCTCATGAATTTACCTCTTCCATCGAAATATAGTTTGTTCATCTTTAATACAGAGATACTCAAGTCTTTTGCGTATTTCCAAGAAAAATATTG

Reverse complement sequence

CAATATTTTTCTTGGAAATACGCAAAAGACTTGAGTATCTCTGTATTAAAGATGAACAAACTATATTTCGATGGAAGAGGTAAATTCATGAGCAATTTGC[C/T]
TTTTGGAGGTCTTGAGCCCACGAATAATACTAAGTTACACGGAATTAGTAGTAGAAAGGGGTGAAAAGGGAGCTGAATTTTGACATGCATCCCTGCAGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.30% 0.02% 0.25% NA
All Indica  2759 97.00% 2.60% 0.04% 0.36% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 16.70% 83.30% 0.00% 0.00% NA
Indica I  595 96.30% 3.20% 0.17% 0.34% NA
Indica II  465 98.30% 1.30% 0.00% 0.43% NA
Indica III  913 99.50% 0.30% 0.00% 0.22% NA
Indica Intermediate  786 94.00% 5.50% 0.00% 0.51% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 22.20% 75.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130714423 G -> A LOC_Os01g53460.1 upstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66 N N N N
vg0130714423 G -> A LOC_Os01g53470.1 upstream_gene_variant ; 4507.0bp to feature; MODIFIER silent_mutation Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66 N N N N
vg0130714423 G -> A LOC_Os01g53450.1 intron_variant ; MODIFIER silent_mutation Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66 N N N N
vg0130714423 G -> A LOC_Os01g53450.2 intron_variant ; MODIFIER silent_mutation Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66 N N N N
vg0130714423 G -> DEL N N silent_mutation Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130714423 NA 8.61E-26 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.62E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 6.23E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 4.41E-10 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.86E-25 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 2.80E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 2.29E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 5.81E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 5.23E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 2.47E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.87E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 2.80E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 9.75E-31 mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 2.07E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.83E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 4.95E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 4.07E-43 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 3.13E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 3.69E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.88E-30 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.27E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 7.05E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 8.56E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 5.25E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 7.56E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423 NA 1.10E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251