Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130714423:

Variant ID: vg0130714423 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30714423
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTGCAGGGATGCATGTCAAAATTCAGCTCCCTTTTCACCCCTTTCTACTACTAATTCCGTGTAACTTAGTATTATTCGTGGGCTCAAGACCTCCAAAA[G/A]
GCAAATTGCTCATGAATTTACCTCTTCCATCGAAATATAGTTTGTTCATCTTTAATACAGAGATACTCAAGTCTTTTGCGTATTTCCAAGAAAAATATTG

Reverse complement sequence

CAATATTTTTCTTGGAAATACGCAAAAGACTTGAGTATCTCTGTATTAAAGATGAACAAACTATATTTCGATGGAAGAGGTAAATTCATGAGCAATTTGC[C/T]
TTTTGGAGGTCTTGAGCCCACGAATAATACTAAGTTACACGGAATTAGTAGTAGAAAGGGGTGAAAAGGGAGCTGAATTTTGACATGCATCCCTGCAGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.30%	0.02%	0.25%	NA
All Indica	2759	97.00%	2.60%	0.04%	0.36%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	16.70%	83.30%	0.00%	0.00%	NA
Indica I	595	96.30%	3.20%	0.17%	0.34%	NA
Indica II	465	98.30%	1.30%	0.00%	0.43%	NA
Indica III	913	99.50%	0.30%	0.00%	0.22%	NA
Indica Intermediate	786	94.00%	5.50%	0.00%	0.51%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	22.20%	75.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130714423	G -> A	LOC_Os01g53460.1	upstream_gene_variant ; 579.0bp to feature; MODIFIER	silent_mutation	Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66	N	N	N	N
vg0130714423	G -> A	LOC_Os01g53470.1	upstream_gene_variant ; 4507.0bp to feature; MODIFIER	silent_mutation	Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66	N	N	N	N
vg0130714423	G -> A	LOC_Os01g53450.1	intron_variant ; MODIFIER	silent_mutation	Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66	N	N	N	N
vg0130714423	G -> A	LOC_Os01g53450.2	intron_variant ; MODIFIER	silent_mutation	Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66	N	N	N	N
vg0130714423	G -> DEL	N	N	silent_mutation	Average:77.248; most accessible tissue: Zhenshan97 flower, score: 90.66	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130714423	NA	8.61E-26	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.62E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	6.23E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	4.41E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.86E-25	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	2.80E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	2.29E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	5.81E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	5.23E-32	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	2.47E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.87E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	2.80E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	9.75E-31	mr1051_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	2.07E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.83E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	4.95E-26	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	4.07E-43	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	3.13E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	3.69E-59	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.88E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.27E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	7.05E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	8.56E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	5.25E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	7.56E-31	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130714423	NA	1.10E-30	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251