Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130661668:

Variant ID: vg0130661668 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30661668
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.09, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTCTATGGCTCGTCCGCTGTCTACTCTTTATTGTCGTTGGGATTTTAAAAATCGAATATAATTATAGTTTGAGTTCATTTTTTTACTTTCTAGAAGTC[T/C]
CACCAAACCGTTAGCGACTTTACCACTGTATTCCTCTATGGCTCACCCGCTGCCTCCCCTCTTTATTGTCGTTAATATATAAAATCGAACATGATTATCA

Reverse complement sequence

TGATAATCATGTTCGATTTTATATATTAACGACAATAAAGAGGGGAGGCAGCGGGTGAGCCATAGAGGAATACAGTGGTAAAGTCGCTAACGGTTTGGTG[A/G]
GACTTCTAGAAAGTAAAAAAATGAACTCAAACTATAATTATATTCGATTTTTAAAATCCCAACGACAATAAAGAGTAGACAGCGGACGAGCCATAGAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	19.30%	0.63%	6.64%	NA
All Indica	2759	98.10%	1.30%	0.18%	0.47%	NA
All Japonica	1512	37.70%	54.90%	1.52%	5.89%	NA
Aus	269	22.30%	0.00%	0.00%	77.70%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	1.80%	0.51%	1.65%	NA
Temperate Japonica	767	24.40%	69.50%	1.69%	4.43%	NA
Tropical Japonica	504	60.70%	36.30%	1.39%	1.59%	NA
Japonica Intermediate	241	32.00%	47.30%	1.24%	19.50%	NA
VI/Aromatic	96	86.50%	12.50%	0.00%	1.04%	NA
Intermediate	90	57.80%	37.80%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130661668	T -> DEL	N	N	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N
vg0130661668	T -> C	LOC_Os01g53360.1	upstream_gene_variant ; 3788.0bp to feature; MODIFIER	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N
vg0130661668	T -> C	LOC_Os01g53370.1	upstream_gene_variant ; 4971.0bp to feature; MODIFIER	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N
vg0130661668	T -> C	LOC_Os01g53350.1	downstream_gene_variant ; 4474.0bp to feature; MODIFIER	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N
vg0130661668	T -> C	LOC_Os01g53350.2	downstream_gene_variant ; 4489.0bp to feature; MODIFIER	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N
vg0130661668	T -> C	LOC_Os01g53360-LOC_Os01g53370	intergenic_region ; MODIFIER	silent_mutation	Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130661668	6.93E-09	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	2.17E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	1.03E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	3.82E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	5.36E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	2.89E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	1.50E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	3.01E-07	NA	mr1074_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	2.29E-07	2.29E-07	mr1074_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	5.63E-07	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	3.13E-07	NA	mr1092_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	5.57E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	2.43E-06	NA	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	9.20E-07	NA	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	2.16E-06	mr1128_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	5.89E-07	NA	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	4.14E-07	NA	mr1154_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668	NA	9.37E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251