\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130661668:

Variant ID: vg0130661668 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30661668
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.09, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCTATGGCTCGTCCGCTGTCTACTCTTTATTGTCGTTGGGATTTTAAAAATCGAATATAATTATAGTTTGAGTTCATTTTTTTACTTTCTAGAAGTC[T/C]
CACCAAACCGTTAGCGACTTTACCACTGTATTCCTCTATGGCTCACCCGCTGCCTCCCCTCTTTATTGTCGTTAATATATAAAATCGAACATGATTATCA

Reverse complement sequence

TGATAATCATGTTCGATTTTATATATTAACGACAATAAAGAGGGGAGGCAGCGGGTGAGCCATAGAGGAATACAGTGGTAAAGTCGCTAACGGTTTGGTG[A/G]
GACTTCTAGAAAGTAAAAAAATGAACTCAAACTATAATTATATTCGATTTTTAAAATCCCAACGACAATAAAGAGTAGACAGCGGACGAGCCATAGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 19.30% 0.63% 6.64% NA
All Indica  2759 98.10% 1.30% 0.18% 0.47% NA
All Japonica  1512 37.70% 54.90% 1.52% 5.89% NA
Aus  269 22.30% 0.00% 0.00% 77.70% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 1.80% 0.51% 1.65% NA
Temperate Japonica  767 24.40% 69.50% 1.69% 4.43% NA
Tropical Japonica  504 60.70% 36.30% 1.39% 1.59% NA
Japonica Intermediate  241 32.00% 47.30% 1.24% 19.50% NA
VI/Aromatic  96 86.50% 12.50% 0.00% 1.04% NA
Intermediate  90 57.80% 37.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130661668 T -> DEL N N silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N
vg0130661668 T -> C LOC_Os01g53360.1 upstream_gene_variant ; 3788.0bp to feature; MODIFIER silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N
vg0130661668 T -> C LOC_Os01g53370.1 upstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N
vg0130661668 T -> C LOC_Os01g53350.1 downstream_gene_variant ; 4474.0bp to feature; MODIFIER silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N
vg0130661668 T -> C LOC_Os01g53350.2 downstream_gene_variant ; 4489.0bp to feature; MODIFIER silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N
vg0130661668 T -> C LOC_Os01g53360-LOC_Os01g53370 intergenic_region ; MODIFIER silent_mutation Average:27.477; most accessible tissue: Zhenshan97 young leaf, score: 39.843 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130661668 6.93E-09 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 2.17E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 1.03E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 3.82E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 5.36E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 2.89E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 1.50E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 3.01E-07 NA mr1074_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 2.29E-07 2.29E-07 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 5.63E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 3.13E-07 NA mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 5.57E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 2.43E-06 NA mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 9.20E-07 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 2.16E-06 mr1128_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 5.89E-07 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 4.14E-07 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130661668 NA 9.37E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251