\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130523627:

Variant ID: vg0130523627 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30523627
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AACGTACAGACTATTATCCAGGTGATTAAACAAAAAACGACCAACTAATTGCTAAAAACAGAGTTTTAACATTTATAAACGATAAATGTACAACGTATTA[C/T]
GTTAACGGAACGGTTTTACTACCGTTAACGTATATACGGCCGATTAATTGGTCGGTATGGCCGTTTTCCACAACACTAAGAACACGTATACAAAAATTTT

Reverse complement sequence

AAAATTTTTGTATACGTGTTCTTAGTGTTGTGGAAAACGGCCATACCGACCAATTAATCGGCCGTATATACGTTAACGGTAGTAAAACCGTTCCGTTAAC[G/A]
TAATACGTTGTACATTTATCGTTTATAAATGTTAAAACTCTGTTTTTAGCAATTAGTTGGTCGTTTTTTGTTTAATCACCTGGATAATAGTCTGTACGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.70% 0.00% 0.00% NA
All Indica  2759 92.10% 7.90% 0.00% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 13.00% 87.00% 0.00% 0.00% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 91.10% 8.90% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.50% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 25.60% 74.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130523627 C -> T LOC_Os01g53090.1 upstream_gene_variant ; 2062.0bp to feature; MODIFIER silent_mutation Average:41.125; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0130523627 C -> T LOC_Os01g53130.2 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:41.125; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0130523627 C -> T LOC_Os01g53130.1 downstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:41.125; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0130523627 C -> T LOC_Os01g53090-LOC_Os01g53130 intergenic_region ; MODIFIER silent_mutation Average:41.125; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130523627 NA 1.46E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 1.97E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 9.16E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 1.42E-06 8.65E-08 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.76E-23 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.05E-08 mr1244 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 1.23E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 5.08E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 1.29E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.95E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 2.22E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 5.60E-64 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.67E-81 mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.65E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 1.98E-12 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 2.06E-27 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 5.60E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 2.95E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 1.98E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.99E-64 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130523627 NA 3.92E-98 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251