Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130351329:

Variant ID: vg0130351329 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30351329
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTTGATCTGCAATGCCTCTATTATTTTATTTTAGGATAAGTAGTCAAGGACTATCGTTTTTGTTAGATCCAACTTCCAAATGCTACTGTGCAGTCTG[T/C]
GCTAGTGCATCTAGCAATTCTAAGGGTAGTGCGGCTGCTAATGTTGATGCACATCCATCAAGAGCAACTGTGTTGATTGAACTATTAATTTGCGCTTTGT

Reverse complement sequence

ACAAAGCGCAAATTAATAGTTCAATCAACACAGTTGCTCTTGATGGATGTGCATCAACATTAGCAGCCGCACTACCCTTAGAATTGCTAGATGCACTAGC[A/G]
CAGACTGCACAGTAGCATTTGGAAGTTGGATCTAACAAAAACGATAGTCCTTGACTACTTATCCTAAAATAAAATAATAGAGGCATTGCAGATCAAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	1.50%	12.44%	32.12%	NA
All Indica	2759	25.10%	2.50%	20.51%	51.87%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	66.50%	0.00%	7.81%	25.65%	NA
Indica I	595	13.80%	0.80%	23.03%	62.35%	NA
Indica II	465	8.60%	4.10%	14.19%	73.12%	NA
Indica III	913	33.70%	3.20%	23.66%	39.43%	NA
Indica Intermediate	786	33.50%	2.00%	18.70%	45.80%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	82.20%	0.00%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130351329	T -> DEL	N	N	silent_mutation	Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962	N	N	N	N
vg0130351329	T -> C	LOC_Os01g52750.1	upstream_gene_variant ; 2314.0bp to feature; MODIFIER	silent_mutation	Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962	N	N	N	N
vg0130351329	T -> C	LOC_Os01g52760.1	upstream_gene_variant ; 500.0bp to feature; MODIFIER	silent_mutation	Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962	N	N	N	N
vg0130351329	T -> C	LOC_Os01g52760.2	upstream_gene_variant ; 500.0bp to feature; MODIFIER	silent_mutation	Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962	N	N	N	N
vg0130351329	T -> C	LOC_Os01g52750-LOC_Os01g52760	intergenic_region ; MODIFIER	silent_mutation	Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130351329	NA	2.28E-42	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	4.65E-06	NA	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	3.19E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.10E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.49E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	8.79E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.37E-22	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.76E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.25E-25	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	1.20E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	1.20E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.69E-26	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	1.01E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	5.91E-14	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	3.67E-06	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.13E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	4.14E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.51E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	5.60E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	7.52E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	9.96E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	6.44E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	4.04E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	1.46E-23	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	1.83E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	NA	2.09E-27	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329	2.75E-06	6.29E-06	mr1944_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251