\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130351329:

Variant ID: vg0130351329 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30351329
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTTGATCTGCAATGCCTCTATTATTTTATTTTAGGATAAGTAGTCAAGGACTATCGTTTTTGTTAGATCCAACTTCCAAATGCTACTGTGCAGTCTG[T/C]
GCTAGTGCATCTAGCAATTCTAAGGGTAGTGCGGCTGCTAATGTTGATGCACATCCATCAAGAGCAACTGTGTTGATTGAACTATTAATTTGCGCTTTGT

Reverse complement sequence

ACAAAGCGCAAATTAATAGTTCAATCAACACAGTTGCTCTTGATGGATGTGCATCAACATTAGCAGCCGCACTACCCTTAGAATTGCTAGATGCACTAGC[A/G]
CAGACTGCACAGTAGCATTTGGAAGTTGGATCTAACAAAAACGATAGTCCTTGACTACTTATCCTAAAATAAAATAATAGAGGCATTGCAGATCAAGCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 1.50% 12.44% 32.12% NA
All Indica  2759 25.10% 2.50% 20.51% 51.87% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 66.50% 0.00% 7.81% 25.65% NA
Indica I  595 13.80% 0.80% 23.03% 62.35% NA
Indica II  465 8.60% 4.10% 14.19% 73.12% NA
Indica III  913 33.70% 3.20% 23.66% 39.43% NA
Indica Intermediate  786 33.50% 2.00% 18.70% 45.80% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 82.20% 0.00% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130351329 T -> DEL N N silent_mutation Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962 N N N N
vg0130351329 T -> C LOC_Os01g52750.1 upstream_gene_variant ; 2314.0bp to feature; MODIFIER silent_mutation Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962 N N N N
vg0130351329 T -> C LOC_Os01g52760.1 upstream_gene_variant ; 500.0bp to feature; MODIFIER silent_mutation Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962 N N N N
vg0130351329 T -> C LOC_Os01g52760.2 upstream_gene_variant ; 500.0bp to feature; MODIFIER silent_mutation Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962 N N N N
vg0130351329 T -> C LOC_Os01g52750-LOC_Os01g52760 intergenic_region ; MODIFIER silent_mutation Average:43.303; most accessible tissue: Zhenshan97 root, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130351329 NA 2.28E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 4.65E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 3.19E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.10E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.49E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 8.79E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.37E-22 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.76E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.25E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 1.20E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 1.20E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.69E-26 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 1.01E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 5.91E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 3.67E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.13E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 4.14E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.51E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 5.60E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 7.52E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 9.96E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 6.44E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 4.04E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 1.46E-23 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 1.83E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 NA 2.09E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130351329 2.75E-06 6.29E-06 mr1944_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251