\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130328652:

Variant ID: vg0130328652 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30328652
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCTGACAAGAAAACAAAACATTCGACCATCAGCTTCGACTTAAACATCTGACACATAATTTTAGTTTGTTAGATTAATCATTTAGAAAAAGAACATC[C/A,T]
GAAATCTCCCTTCCTCCCTGCTCGCGTACAACGTGCGCCATTCTTTTCTCTCTATTTTTTATCTCCTTATCAACTGAAATTAAAATTATCTATATGTAAA

Reverse complement sequence

TTTACATATAGATAATTTTAATTTCAGTTGATAAGGAGATAAAAAATAGAGAGAAAAGAATGGCGCACGTTGTACGCGAGCAGGGAGGAAGGGAGATTTC[G/T,A]
GATGTTCTTTTTCTAAATGATTAATCTAACAAACTAAAATTATGTGTCAGATGTTTAAGTCGAAGCTGATGGTCGAATGTTTTGTTTTCTTGTCAGAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.50% 0.38% 0.00% NA
All Indica  2759 97.60% 1.80% 0.51% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.80% 0.70% 1.53% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 9.40% 4.17% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130328652 C -> T LOC_Os01g52730.1 upstream_gene_variant ; 3567.0bp to feature; MODIFIER N Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0130328652 C -> T LOC_Os01g52720.1 downstream_gene_variant ; 4659.0bp to feature; MODIFIER N Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0130328652 C -> T LOC_Os01g52730-LOC_Os01g52740 intergenic_region ; MODIFIER N Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0130328652 C -> A LOC_Os01g52730.1 upstream_gene_variant ; 3567.0bp to feature; MODIFIER silent_mutation Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0130328652 C -> A LOC_Os01g52720.1 downstream_gene_variant ; 4659.0bp to feature; MODIFIER silent_mutation Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0130328652 C -> A LOC_Os01g52730-LOC_Os01g52740 intergenic_region ; MODIFIER silent_mutation Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130328652 NA 5.16E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 1.59E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 4.41E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 1.51E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 2.11E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 2.37E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 3.26E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 2.44E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 5.71E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 NA 4.60E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 1.04E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 8.26E-07 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 1.48E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 2.35E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 5.59E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 3.37E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 2.86E-08 NA mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 2.41E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652 1.04E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251