Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0130328652:

Variant ID: vg0130328652 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30328652
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AATTCTGACAAGAAAACAAAACATTCGACCATCAGCTTCGACTTAAACATCTGACACATAATTTTAGTTTGTTAGATTAATCATTTAGAAAAAGAACATC[C/A,T]
GAAATCTCCCTTCCTCCCTGCTCGCGTACAACGTGCGCCATTCTTTTCTCTCTATTTTTTATCTCCTTATCAACTGAAATTAAAATTATCTATATGTAAA

Reverse complement sequence

TTTACATATAGATAATTTTAATTTCAGTTGATAAGGAGATAAAAAATAGAGAGAAAAGAATGGCGCACGTTGTACGCGAGCAGGGAGGAAGGGAGATTTC[G/T,A]
GATGTTCTTTTTCTAAATGATTAATCTAACAAACTAAAATTATGTGTCAGATGTTTAAGTCGAAGCTGATGGTCGAATGTTTTGTTTTCTTGTCAGAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.50%	0.38%	0.00%	NA
All Indica	2759	97.60%	1.80%	0.51%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	10.40%	89.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.80%	0.70%	1.53%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	9.40%	4.17%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130328652	C -> T	LOC_Os01g52730.1	upstream_gene_variant ; 3567.0bp to feature; MODIFIER	N	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0130328652	C -> T	LOC_Os01g52720.1	downstream_gene_variant ; 4659.0bp to feature; MODIFIER	N	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0130328652	C -> T	LOC_Os01g52730-LOC_Os01g52740	intergenic_region ; MODIFIER	N	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0130328652	C -> A	LOC_Os01g52730.1	upstream_gene_variant ; 3567.0bp to feature; MODIFIER	silent_mutation	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0130328652	C -> A	LOC_Os01g52720.1	downstream_gene_variant ; 4659.0bp to feature; MODIFIER	silent_mutation	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0130328652	C -> A	LOC_Os01g52730-LOC_Os01g52740	intergenic_region ; MODIFIER	silent_mutation	Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130328652	NA	5.16E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	1.59E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	4.41E-08	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	1.51E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	2.11E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	2.37E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	3.26E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	2.44E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	5.71E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	NA	4.60E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	1.04E-06	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	8.26E-07	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	1.48E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	2.35E-06	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	5.59E-07	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	3.37E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	2.86E-08	NA	mr1242_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	2.41E-06	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130328652	1.04E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251