\
| Variant ID: vg0130328652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30328652 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )
AATTCTGACAAGAAAACAAAACATTCGACCATCAGCTTCGACTTAAACATCTGACACATAATTTTAGTTTGTTAGATTAATCATTTAGAAAAAGAACATC[C/A,T]
GAAATCTCCCTTCCTCCCTGCTCGCGTACAACGTGCGCCATTCTTTTCTCTCTATTTTTTATCTCCTTATCAACTGAAATTAAAATTATCTATATGTAAA
TTTACATATAGATAATTTTAATTTCAGTTGATAAGGAGATAAAAAATAGAGAGAAAAGAATGGCGCACGTTGTACGCGAGCAGGGAGGAAGGGAGATTTC[G/T,A]
GATGTTCTTTTTCTAAATGATTAATCTAACAAACTAAAATTATGTGTCAGATGTTTAAGTCGAAGCTGATGGTCGAATGTTTTGTTTTCTTGTCAGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.50% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 1.80% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 0.70% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 9.40% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130328652 | C -> T | LOC_Os01g52730.1 | upstream_gene_variant ; 3567.0bp to feature; MODIFIER | N | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0130328652 | C -> T | LOC_Os01g52720.1 | downstream_gene_variant ; 4659.0bp to feature; MODIFIER | N | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0130328652 | C -> T | LOC_Os01g52730-LOC_Os01g52740 | intergenic_region ; MODIFIER | N | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0130328652 | C -> A | LOC_Os01g52730.1 | upstream_gene_variant ; 3567.0bp to feature; MODIFIER | silent_mutation | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0130328652 | C -> A | LOC_Os01g52720.1 | downstream_gene_variant ; 4659.0bp to feature; MODIFIER | silent_mutation | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0130328652 | C -> A | LOC_Os01g52730-LOC_Os01g52740 | intergenic_region ; MODIFIER | silent_mutation | Average:15.251; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130328652 | NA | 5.16E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 1.59E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 4.41E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 1.51E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 2.11E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 2.37E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 3.26E-07 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 2.44E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 5.71E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | NA | 4.60E-11 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 1.04E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 8.26E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 1.48E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 2.35E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 5.59E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 3.37E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 2.86E-08 | NA | mr1242_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 2.41E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130328652 | 1.04E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |