Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130267498:

Variant ID: vg0130267498 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30267498
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGATTATCTTTATAACTTAACTTCAGCTTGACTAATCTTTAACTGAATTCTCTGAAATTATTTCTTTATGTCAATATATGACTTACTGATATAAGCC[C/T]
AGTACTCCTTCAGACCAAAATAATTCATGGAAAAATTTCCTTTAATTTCTAACAGCAATATGTATTGCTTGACAATAAAATGTCATTAGTATGGAGTACC

Reverse complement sequence

GGTACTCCATACTAATGACATTTTATTGTCAAGCAATACATATTGCTGTTAGAAATTAAAGGAAATTTTTCCATGAATTATTTTGGTCTGAAGGAGTACT[G/A]
GGCTTATATCAGTAAGTCATATATTGACATAAAGAAATAATTTCAGAGAATTCAGTTAAAGATTAGTCAAGCTGAAGTTAAGTTATAAAGATAATCATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.90%	0.42%	0.00%	NA
All Indica	2759	95.80%	3.60%	0.62%	0.00%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	94.60%	3.90%	1.51%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	6.10%	1.02%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	82.30%	1.04%	0.00%	NA
Intermediate	90	30.00%	67.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130267498	C -> T	LOC_Os01g52650.1	upstream_gene_variant ; 3117.0bp to feature; MODIFIER	silent_mutation	Average:30.011; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0130267498	C -> T	LOC_Os01g52640.3	downstream_gene_variant ; 3509.0bp to feature; MODIFIER	silent_mutation	Average:30.011; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0130267498	C -> T	LOC_Os01g52650-LOC_Os01g52660	intergenic_region ; MODIFIER	silent_mutation	Average:30.011; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130267498	NA	1.89E-111	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.38E-110	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	2.40E-75	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	8.42E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.25E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.11E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.55E-112	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	5.16E-88	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	2.08E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	5.28E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	5.23E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.66E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	2.18E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	2.37E-13	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	6.37E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	7.32E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	8.82E-06	NA	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	NA	1.96E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130267498	3.49E-06	NA	mr1825_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251