\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130151904:

Variant ID: vg0130151904 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 30151904
Reference Allele: CAlternative Allele: T,CA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATTGGATTTTATAGTTTTTAGAGTTTATTGTCATGTTGGGTTTCTTTTTATAATTTCTAGATGCCCCCCATCAAACGTTGCCATTATACTCCTCTA[C/T,CA]
GACCCGTCCACTGTCTCTTCTCTTTATTATCATTGAGATTTAAAAAATCGAACATAATTGTCGTTTTGGTTCATTTTTACTTTCTAGAAGTCCTGCCAAA

Reverse complement sequence

TTTGGCAGGACTTCTAGAAAGTAAAAATGAACCAAAACGACAATTATGTTCGATTTTTTAAATCTCAATGATAATAAAGAGAAGAGACAGTGGACGGGTC[G/A,TG]
TAGAGGAGTATAATGGCAACGTTTGATGGGGGGCATCTAGAAATTATAAAAAGAAACCCAACATGACAATAAACTCTAAAAACTATAAAATCCAATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.60% 0.00% 0.00% NA
All Indica  2759 86.10% 13.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 78.50% 21.50% 0.00% 0.00% NA
Indica Intermediate  786 83.20% 16.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130151904 C -> T LOC_Os01g52480.1 upstream_gene_variant ; 3761.0bp to feature; MODIFIER silent_mutation Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0130151904 C -> T LOC_Os01g52470-LOC_Os01g52480 intergenic_region ; MODIFIER silent_mutation Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0130151904 C -> CA LOC_Os01g52480.1 upstream_gene_variant ; 3760.0bp to feature; MODIFIER N Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0130151904 C -> CA LOC_Os01g52470-LOC_Os01g52480 intergenic_region ; MODIFIER N Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130151904 NA 9.96E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 1.92E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 6.57E-07 6.57E-07 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 3.55E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 8.21E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 9.30E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 1.91E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904 NA 4.10E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251