Variant ID: vg0130151904 (JBrowse) | Variation Type: INDEL |
Chromosome: chr01 | Position: 30151904 |
Reference Allele: C | Alternative Allele: T,CA |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAATTGGATTTTATAGTTTTTAGAGTTTATTGTCATGTTGGGTTTCTTTTTATAATTTCTAGATGCCCCCCATCAAACGTTGCCATTATACTCCTCTA[C/T,CA]
GACCCGTCCACTGTCTCTTCTCTTTATTATCATTGAGATTTAAAAAATCGAACATAATTGTCGTTTTGGTTCATTTTTACTTTCTAGAAGTCCTGCCAAA
TTTGGCAGGACTTCTAGAAAGTAAAAATGAACCAAAACGACAATTATGTTCGATTTTTTAAATCTCAATGATAATAAAGAGAAGAGACAGTGGACGGGTC[G/A,TG]
TAGAGGAGTATAATGGCAACGTTTGATGGGGGGCATCTAGAAATTATAAAAAGAAACCCAACATGACAATAAACTCTAAAAACTATAAAATCCAATTTTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
All Indica | 2759 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0130151904 | C -> T | LOC_Os01g52480.1 | upstream_gene_variant ; 3761.0bp to feature; MODIFIER | silent_mutation | Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0130151904 | C -> T | LOC_Os01g52470-LOC_Os01g52480 | intergenic_region ; MODIFIER | silent_mutation | Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0130151904 | C -> CA | LOC_Os01g52480.1 | upstream_gene_variant ; 3760.0bp to feature; MODIFIER | N | Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
vg0130151904 | C -> CA | LOC_Os01g52470-LOC_Os01g52480 | intergenic_region ; MODIFIER | N | Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0130151904 | NA | 9.96E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 1.92E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | 6.57E-07 | 6.57E-07 | mr1449 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 3.55E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 8.21E-06 | mr1364_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 9.30E-06 | mr1954_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 1.91E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130151904 | NA | 4.10E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |