Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130151904:

Variant ID: vg0130151904 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 30151904
Reference Allele: C	Alternative Allele: T,CA
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTGGATTTTATAGTTTTTAGAGTTTATTGTCATGTTGGGTTTCTTTTTATAATTTCTAGATGCCCCCCATCAAACGTTGCCATTATACTCCTCTA[C/T,CA]
GACCCGTCCACTGTCTCTTCTCTTTATTATCATTGAGATTTAAAAAATCGAACATAATTGTCGTTTTGGTTCATTTTTACTTTCTAGAAGTCCTGCCAAA

Reverse complement sequence

TTTGGCAGGACTTCTAGAAAGTAAAAATGAACCAAAACGACAATTATGTTCGATTTTTTAAATCTCAATGATAATAAAGAGAAGAGACAGTGGACGGGTC[G/A,TG]
TAGAGGAGTATAATGGCAACGTTTGATGGGGGGCATCTAGAAATTATAAAAAGAAACCCAACATGACAATAAACTCTAAAAACTATAAAATCCAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.60%	0.00%	0.00%	NA
All Indica	2759	86.10%	13.90%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	90.90%	9.10%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	78.50%	21.50%	0.00%	0.00%	NA
Indica Intermediate	786	83.20%	16.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130151904	C -> T	LOC_Os01g52480.1	upstream_gene_variant ; 3761.0bp to feature; MODIFIER	silent_mutation	Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0130151904	C -> T	LOC_Os01g52470-LOC_Os01g52480	intergenic_region ; MODIFIER	silent_mutation	Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0130151904	C -> CA	LOC_Os01g52480.1	upstream_gene_variant ; 3760.0bp to feature; MODIFIER	N	Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0130151904	C -> CA	LOC_Os01g52470-LOC_Os01g52480	intergenic_region ; MODIFIER	N	Average:30.43; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130151904	NA	9.96E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	1.92E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	6.57E-07	6.57E-07	mr1449	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	3.55E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	8.21E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	9.30E-06	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	1.91E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130151904	NA	4.10E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251