Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130147387:

Variant ID: vg0130147387 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30147387
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCTTAAGCCTGATAGTAGAATGGACGAATAAGTTCACATTGACTCCCTTAATTAGTGGTCGAATCTAAATCATATCCCTAAACTACAATACTGGATAT[T/A]
TCGACCCCAAACTATTAAAACTGGTGCAATATCACTCCCTTGGCGGTTTTGTAGGGTGGTTTTGCTGACGTGGCGCATACGTGACGGCATTGACTTGGTC

Reverse complement sequence

GACCAAGTCAATGCCGTCACGTATGCGCCACGTCAGCAAAACCACCCTACAAAACCGCCAAGGGAGTGATATTGCACCAGTTTTAATAGTTTGGGGTCGA[A/T]
ATATCCAGTATTGTAGTTTAGGGATATGATTTAGATTCGACCACTAATTAAGGGAGTCAATGTGAACTTATTCGTCCATTCTACTATCAGGCTTAAGCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 8.10% 1.52% 3.05% NA
All Indica  2759 86.90% 13.00% 0.00% 0.07% NA
All Japonica  1512 91.50% 0.00% 4.03% 4.43% NA
Aus  269 89.20% 8.60% 0.37% 1.86% NA
Indica I  595 90.60% 9.40% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 80.20% 19.80% 0.00% 0.00% NA
Indica Intermediate  786 84.40% 15.40% 0.00% 0.25% NA
Temperate Japonica  767 99.50% 0.00% 0.39% 0.13% NA
Tropical Japonica  504 78.60% 0.00% 9.92% 11.51% NA
Japonica Intermediate  241 93.40% 0.00% 3.32% 3.32% NA
VI/Aromatic  96 28.10% 0.00% 7.29% 64.58% NA
Intermediate  90 86.70% 1.10% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130147387 T -> A LOC_Os01g52470.1 upstream_gene_variant ; 560.0bp to feature; MODIFIER silent_mutation Average:97.754; most accessible tissue: Zhenshan97 root, score: 99.707 N N N N
vg0130147387 T -> A LOC_Os01g52470-LOC_Os01g52480 intergenic_region ; MODIFIER silent_mutation Average:97.754; most accessible tissue: Zhenshan97 root, score: 99.707 N N N N
vg0130147387 T -> DEL N N silent_mutation Average:97.754; most accessible tissue: Zhenshan97 root, score: 99.707 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130147387 T A 0.0 -0.02 -0.03 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130147387 6.30E-07 6.30E-07 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130147387 NA 1.85E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130147387 NA 8.00E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251