Variant ID: vg0130082160 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 30082160 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAAACATATATTTAAAAGTCAGCGGCGTCATCTATTAAAAAATGAAGGGAGTATATTACCCAAATGGAAGAGTCCCTCTTCAAAATAGGTCTAATAGAT[A/G]
AGCTATATAAGCGATATATTGATTTTCCTTTCCAACAATGGGCTTGATGTGATAGCATAAGCCTTTGTAGCAATCAAGACTAGTAAGTCCATTAATCCAA
TTGGATTAATGGACTTACTAGTCTTGATTGCTACAAAGGCTTATGCTATCACATCAAGCCCATTGTTGGAAAGGAAAATCAATATATCGCTTATATAGCT[T/C]
ATCTATTAGACCTATTTTGAAGAGGGACTCTTCCATTTGGGTAATATACTCCCTTCATTTTTTAATAGATGACGCCGCTGACTTTTAAATATATGTTTGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0130082160 | A -> G | LOC_Os01g52340.1 | downstream_gene_variant ; 660.0bp to feature; MODIFIER | silent_mutation | Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
vg0130082160 | A -> G | LOC_Os01g52370.1 | downstream_gene_variant ; 4177.0bp to feature; MODIFIER | silent_mutation | Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
vg0130082160 | A -> G | LOC_Os01g52340-LOC_Os01g52370 | intergenic_region ; MODIFIER | silent_mutation | Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0130082160 | NA | 4.85E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0130082160 | 1.16E-08 | 1.02E-10 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |