\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130082160:

Variant ID: vg0130082160 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30082160
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACATATATTTAAAAGTCAGCGGCGTCATCTATTAAAAAATGAAGGGAGTATATTACCCAAATGGAAGAGTCCCTCTTCAAAATAGGTCTAATAGAT[A/G]
AGCTATATAAGCGATATATTGATTTTCCTTTCCAACAATGGGCTTGATGTGATAGCATAAGCCTTTGTAGCAATCAAGACTAGTAAGTCCATTAATCCAA

Reverse complement sequence

TTGGATTAATGGACTTACTAGTCTTGATTGCTACAAAGGCTTATGCTATCACATCAAGCCCATTGTTGGAAAGGAAAATCAATATATCGCTTATATAGCT[T/C]
ATCTATTAGACCTATTTTGAAGAGGGACTCTTCCATTTGGGTAATATACTCCCTTCATTTTTTAATAGATGACGCCGCTGACTTTTAAATATATGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.70% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 91.90% 8.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 76.20% 23.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130082160 A -> G LOC_Os01g52340.1 downstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 N N N N
vg0130082160 A -> G LOC_Os01g52370.1 downstream_gene_variant ; 4177.0bp to feature; MODIFIER silent_mutation Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 N N N N
vg0130082160 A -> G LOC_Os01g52340-LOC_Os01g52370 intergenic_region ; MODIFIER silent_mutation Average:52.712; most accessible tissue: Minghui63 flower, score: 68.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130082160 NA 4.85E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130082160 1.16E-08 1.02E-10 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251