\
| Variant ID: vg0129933965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29933965 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGAAACCATTGAGACGGTGTTTGATATGAAGATAAAAATTAAGTGTTTTATGTAAAACGAGGTGATAATAACGTGTGATTAATCGAGTTTTAATTATTA[T/C]
AAATTTGAAATTGGATTAATCTGATATTTTAGAACAACTTTTATATAAAAAGTTTTCACACGAAACATGCCGTTTAGTAGTTTGAAAAACGTGCCACTTT
AAAGTGGCACGTTTTTCAAACTACTAAACGGCATGTTTCGTGTGAAAACTTTTTATATAAAAGTTGTTCTAAAATATCAGATTAATCCAATTTCAAATTT[A/G]
TAATAATTAAAACTCGATTAATCACACGTTATTATCACCTCGTTTTACATAAAACACTTAATTTTTATCTTCATATCAAACACCGTCTCAATGGTTTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 25.50% | 74.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129933965 | T -> C | LOC_Os01g52050.1 | upstream_gene_variant ; 2478.0bp to feature; MODIFIER | silent_mutation | Average:37.87; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0129933965 | T -> C | LOC_Os01g52060.1 | upstream_gene_variant ; 3583.0bp to feature; MODIFIER | silent_mutation | Average:37.87; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0129933965 | T -> C | LOC_Os01g52050-LOC_Os01g52060 | intergenic_region ; MODIFIER | silent_mutation | Average:37.87; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129933965 | NA | 2.23E-08 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.25E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 2.21E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 5.08E-14 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 6.07E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.73E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 2.03E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | 2.51E-06 | 4.85E-12 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 4.83E-12 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | 8.97E-07 | 1.91E-19 | mr1540 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 4.75E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 5.93E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.60E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 3.90E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | 6.80E-07 | 1.01E-19 | mr1732 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 5.93E-16 | mr1732 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 7.59E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 2.97E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 2.94E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 3.37E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 5.77E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 2.69E-22 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 7.38E-25 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.81E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 9.51E-20 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 7.22E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 7.89E-20 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 8.32E-17 | mr1540_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 5.57E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.82E-16 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.11E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 9.85E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 8.51E-20 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.70E-15 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129933965 | NA | 1.15E-14 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |