Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129594569:

Variant ID: vg0129594569 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29594569
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAATGGAAAACATTATTCCTTGGTAAGGATATGGAGTAATAACAATTTGATTTATAGCATTGAAGGTTTTCGTTTTTTAATTTTGTTGCATCGAAAGT[C/T]
GTCACTTAACTTTGGTAACACACCCATATCTCGCTCTCCATTCAATCGAACTCATCTCGTCTTCTTTGAACGTGATTCACTTAGCCAGACATTGCCAATT

Reverse complement sequence

AATTGGCAATGTCTGGCTAAGTGAATCACGTTCAAAGAAGACGAGATGAGTTCGATTGAATGGAGAGCGAGATATGGGTGTGTTACCAAAGTTAAGTGAC[G/A]
ACTTTCGATGCAACAAAATTAAAAAACGAAAACCTTCAATGCTATAAATCAAATTGTTATTACTCCATATCCTTACCAAGGAATAATGTTTTCCATTCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.20%	0.13%	0.00%	NA
All Indica	2759	90.60%	9.20%	0.18%	0.00%	NA
All Japonica	1512	28.90%	71.10%	0.00%	0.00%	NA
Aus	269	9.70%	90.30%	0.00%	0.00%	NA
Indica I	595	96.80%	2.90%	0.34%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	86.60%	13.40%	0.00%	0.00%	NA
Indica Intermediate	786	86.00%	13.70%	0.25%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	81.50%	18.50%	0.00%	0.00%	NA
Japonica Intermediate	241	8.70%	91.30%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	43.30%	55.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129594569	C -> T	LOC_Os01g51490.1	upstream_gene_variant ; 4226.0bp to feature; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N
vg0129594569	C -> T	LOC_Os01g51500.1	upstream_gene_variant ; 1222.0bp to feature; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N
vg0129594569	C -> T	LOC_Os01g51510.1	downstream_gene_variant ; 243.0bp to feature; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N
vg0129594569	C -> T	LOC_Os01g51520.1	downstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N
vg0129594569	C -> T	LOC_Os01g51530.1	downstream_gene_variant ; 4312.0bp to feature; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N
vg0129594569	C -> T	LOC_Os01g51510-LOC_Os01g51520	intergenic_region ; MODIFIER	silent_mutation	Average:35.924; most accessible tissue: Callus, score: 75.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129594569	NA	2.95E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.65E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	4.25E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	4.30E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	5.35E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.41E-11	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.32E-15	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.56E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	5.21E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.16E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.05E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.34E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.04E-15	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	4.87E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	6.45E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	5.35E-06	NA	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.08E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.99E-13	mr1364_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	2.05E-06	mr1364_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	4.85E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.39E-06	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.06E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	3.76E-23	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	1.48E-13	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	2.99E-18	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569	NA	9.78E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251