\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129594569:

Variant ID: vg0129594569 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29594569
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAATGGAAAACATTATTCCTTGGTAAGGATATGGAGTAATAACAATTTGATTTATAGCATTGAAGGTTTTCGTTTTTTAATTTTGTTGCATCGAAAGT[C/T]
GTCACTTAACTTTGGTAACACACCCATATCTCGCTCTCCATTCAATCGAACTCATCTCGTCTTCTTTGAACGTGATTCACTTAGCCAGACATTGCCAATT

Reverse complement sequence

AATTGGCAATGTCTGGCTAAGTGAATCACGTTCAAAGAAGACGAGATGAGTTCGATTGAATGGAGAGCGAGATATGGGTGTGTTACCAAAGTTAAGTGAC[G/A]
ACTTTCGATGCAACAAAATTAAAAAACGAAAACCTTCAATGCTATAAATCAAATTGTTATTACTCCATATCCTTACCAAGGAATAATGTTTTCCATTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.20% 0.13% 0.00% NA
All Indica  2759 90.60% 9.20% 0.18% 0.00% NA
All Japonica  1512 28.90% 71.10% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 96.80% 2.90% 0.34% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 86.60% 13.40% 0.00% 0.00% NA
Indica Intermediate  786 86.00% 13.70% 0.25% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 18.50% 0.00% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129594569 C -> T LOC_Os01g51490.1 upstream_gene_variant ; 4226.0bp to feature; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N
vg0129594569 C -> T LOC_Os01g51500.1 upstream_gene_variant ; 1222.0bp to feature; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N
vg0129594569 C -> T LOC_Os01g51510.1 downstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N
vg0129594569 C -> T LOC_Os01g51520.1 downstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N
vg0129594569 C -> T LOC_Os01g51530.1 downstream_gene_variant ; 4312.0bp to feature; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N
vg0129594569 C -> T LOC_Os01g51510-LOC_Os01g51520 intergenic_region ; MODIFIER silent_mutation Average:35.924; most accessible tissue: Callus, score: 75.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129594569 NA 2.95E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.65E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 4.25E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 4.30E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 5.35E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.41E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.32E-15 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.56E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 5.21E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.16E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.05E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.34E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.04E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 4.87E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 6.45E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 5.35E-06 NA mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.08E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.99E-13 mr1364_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 2.05E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 4.85E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.39E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.06E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 3.76E-23 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 1.48E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 2.99E-18 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129594569 NA 9.78E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251