Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129101290:

Variant ID: vg0129101290 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29101290
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGCGTTCAGGAGGGCTACCGAGCTACCACGCGAGCTAAAAGAGGGAGAGGGCAAGCGAGAAGGGAGAACGGAGGGAGGCACTACCGAGCCGAGACGGGC[G/A]
CTGTGACGAGCGGCCGACGGCGCGGGGCATGATCGCTACGGCCTCGGGCCGGGGAAGAGGAAGATGAGGGTGCCCGGAGTCCGCGTTAGCTCCTCGCGCG

Reverse complement sequence

CGCGCGAGGAGCTAACGCGGACTCCGGGCACCCTCATCTTCCTCTTCCCCGGCCCGAGGCCGTAGCGATCATGCCCCGCGCCGTCGGCCGCTCGTCACAG[C/T]
GCCCGTCTCGGCTCGGTAGTGCCTCCCTCCGTTCTCCCTTCTCGCTTGCCCTCTCCCTCTTTTAGCTCGCGTGGTAGCTCGGTAGCCCTCCTGAACGCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	12.10%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	66.20%	33.80%	0.00%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	88.00%	12.00%	0.00%	0.00%	NA
Tropical Japonica	504	44.40%	55.60%	0.00%	0.00%	NA
Japonica Intermediate	241	42.30%	57.70%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129101290	G -> A	LOC_Os01g50670.1	missense_variant ; p.Ala214Thr; MODERATE	nonsynonymous_codon ; A214T	Average:82.247; most accessible tissue: Minghui63 flag leaf, score: 91.949	unknown	unknown	TOLERATED	0.06

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0129101290	G	A	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129101290	NA	6.06E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	2.99E-06	NA	mr1362	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	1.66E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	7.60E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	8.59E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	2.52E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	1.13E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	2.36E-09	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	2.42E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290	NA	5.08E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251