Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129101290:

Variant ID: vg0129101290 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29101290
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGTTCAGGAGGGCTACCGAGCTACCACGCGAGCTAAAAGAGGGAGAGGGCAAGCGAGAAGGGAGAACGGAGGGAGGCACTACCGAGCCGAGACGGGC[G/A]
CTGTGACGAGCGGCCGACGGCGCGGGGCATGATCGCTACGGCCTCGGGCCGGGGAAGAGGAAGATGAGGGTGCCCGGAGTCCGCGTTAGCTCCTCGCGCG

Reverse complement sequence

CGCGCGAGGAGCTAACGCGGACTCCGGGCACCCTCATCTTCCTCTTCCCCGGCCCGAGGCCGTAGCGATCATGCCCCGCGCCGTCGGCCGCTCGTCACAG[C/T]
GCCCGTCTCGGCTCGGTAGTGCCTCCCTCCGTTCTCCCTTCTCGCTTGCCCTCTCCCTCTTTTAGCTCGCGTGGTAGCTCGGTAGCCCTCCTGAACGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.10% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 66.20% 33.80% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 88.00% 12.00% 0.00% 0.00% NA
Tropical Japonica  504 44.40% 55.60% 0.00% 0.00% NA
Japonica Intermediate  241 42.30% 57.70% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129101290 G -> A LOC_Os01g50670.1 missense_variant ; p.Ala214Thr; MODERATE nonsynonymous_codon ; A214T Average:82.247; most accessible tissue: Minghui63 flag leaf, score: 91.949 unknown unknown TOLERATED 0.06

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129101290 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129101290 NA 6.06E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 2.99E-06 NA mr1362 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 1.66E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 7.60E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 8.59E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 2.52E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 1.13E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 2.36E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 2.42E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129101290 NA 5.08E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251