Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0128962067:

Variant ID: vg0128962067 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 28962067
Reference Allele: C	Alternative Allele: CTCTCTA,CTCTCTCTA,CTCTA
Primary Allele: CTCTCTA	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTCTCGAGACCGAGAGACCCACGTCTTTATCTCTCGATCTCTATATGTTCGCTAGTTCTCCCTCGATCCTCTTTCTCTTCACTCACTCACTCTCTCT[C/CTCTCTA,CTCTCTCTA,CTCTA]
TCTCTCTAGCAAAGGCTGGCCAAGAGAAGTGGTAGCTGGGCGGGGTCGGTGGTGGCTGGGCGGGAGAAGCGGCGGCGGCTGAGCGGGAGAAGAAGCATCG

Reverse complement sequence

CGATGCTTCTTCTCCCGCTCAGCCGCCGCCGCTTCTCCCGCCCAGCCACCACCGACCCCGCCCAGCTACCACTTCTCTTGGCCAGCCTTTGCTAGAGAGA[G/TAGAGAG,TAGAGAGAG,TAGAG]
AGAGAGAGTGAGTGAGTGAAGAGAAAGAGGATCGAGGGAGAACTAGCGAACATATAGAGATCGAGAGATAAAGACGTGGGTCTCTCGGTCTCGAGAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of CTCTCTA(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	38.50%	3.91%	0.00%	CTCTCTCTA: 0.08%; CTCTA: 0.02%
All Indica	2759	81.20%	13.10%	5.55%	0.00%	CTCTCTCTA: 0.14%; CTCTA: 0.04%
All Japonica	1512	9.50%	89.90%	0.66%	0.00%	NA
Aus	269	83.30%	10.40%	6.32%	0.00%	NA
Indica I	595	85.00%	8.40%	6.55%	0.00%	NA
Indica II	465	87.50%	6.20%	6.24%	0.00%	NA
Indica III	913	76.90%	18.30%	4.27%	0.00%	CTCTCTCTA: 0.44%; CTCTA: 0.11%
Indica Intermediate	786	79.40%	14.80%	5.85%	0.00%	NA
Temperate Japonica	767	0.10%	99.70%	0.13%	0.00%	NA
Tropical Japonica	504	26.60%	71.80%	1.59%	0.00%	NA
Japonica Intermediate	241	3.30%	96.30%	0.41%	0.00%	NA
VI/Aromatic	96	75.00%	21.90%	3.12%	0.00%	NA
Intermediate	90	44.40%	53.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128962067	C -> CTCTCTCTA	LOC_Os01g50440-LOC_Os01g50450	intergenic_region ; MODIFIER	silent_mutation	Average:70.306; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0128962067	C -> CTCTA	LOC_Os01g50440-LOC_Os01g50450	intergenic_region ; MODIFIER	silent_mutation	Average:70.306; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0128962067	C -> CTCTCTA	LOC_Os01g50440-LOC_Os01g50450	intergenic_region ; MODIFIER	silent_mutation	Average:70.306; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128962067	NA	2.64E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	5.16E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	2.06E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	1.78E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	3.80E-06	1.64E-06	mr1263_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	4.91E-06	mr1511_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	6.56E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	7.98E-10	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	5.64E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128962067	NA	8.85E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251