\
| Variant ID: vg0128646920 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28646920 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )
CAGGAACCGTTTGGAGCTTTTGTTATGTGCTGTTAATTTGAACCTCCTTTATCACTTTTGTTATGTGCAGTTCGACTTTGCAGCTGTTAATTTGATGTTA[T/A]
GGAAGTATTATTTGGGTTGTTTGTGTTGCATCGATGAACTTATTCACATATTTTGGCTACTTTCAATCATATATGTCTGAATTCAACCTGGCATCTGTTT
AAACAGATGCCAGGTTGAATTCAGACATATATGATTGAAAGTAGCCAAAATATGTGAATAAGTTCATCGATGCAACACAAACAACCCAAATAATACTTCC[A/T]
TAACATCAAATTAACAGCTGCAAAGTCGAACTGCACATAACAAAAGTGATAAAGGAGGTTCAAATTAACAGCACATAACAAAAGCTCCAAACGGTTCCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 39.20% | 2.33% | 17.16% | NA |
| All Indica | 2759 | 67.30% | 7.00% | 3.23% | 22.51% | NA |
| All Japonica | 1512 | 1.40% | 87.70% | 0.79% | 10.12% | NA |
| Aus | 269 | 16.70% | 82.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 80.70% | 5.50% | 2.35% | 11.43% | NA |
| Indica II | 465 | 45.60% | 5.60% | 4.30% | 44.52% | NA |
| Indica III | 913 | 70.30% | 4.70% | 2.63% | 22.34% | NA |
| Indica Intermediate | 786 | 66.40% | 11.60% | 3.94% | 18.07% | NA |
| Temperate Japonica | 767 | 0.30% | 99.30% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 3.40% | 67.10% | 1.79% | 27.78% | NA |
| Japonica Intermediate | 241 | 0.80% | 93.80% | 0.83% | 4.56% | NA |
| VI/Aromatic | 96 | 5.20% | 60.40% | 3.12% | 31.25% | NA |
| Intermediate | 90 | 30.00% | 57.80% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128646920 | T -> A | LOC_Os01g49880.1 | upstream_gene_variant ; 3861.0bp to feature; MODIFIER | silent_mutation | Average:19.725; most accessible tissue: Callus, score: 43.031 | N | N | N | N |
| vg0128646920 | T -> A | LOC_Os01g49870.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.725; most accessible tissue: Callus, score: 43.031 | N | N | N | N |
| vg0128646920 | T -> DEL | N | N | silent_mutation | Average:19.725; most accessible tissue: Callus, score: 43.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128646920 | NA | 4.55E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 1.69E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 1.46E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 7.42E-42 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 2.53E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 3.12E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 1.86E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 1.59E-09 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 3.70E-13 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 4.13E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 3.40E-08 | mr1989 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128646920 | NA | 6.73E-47 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |