\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128560757:

Variant ID: vg0128560757 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28560757
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAGAACACTAAATTAGATTCAATGAATATACATTGGTAATATGTTTGTTCTGTGTTGGAAATGCTACTTTATCTATAAACTCAATCAAACTTTAAAAA[T/A]
TTTTATTAGAAAAAAGTCAAAATGATTTATGAAATGAAACGGAGTACACTATCCTATCTCGTCGATTATGTAAGATTGACCACTTACATTCGGACACGTT

Reverse complement sequence

AACGTGTCCGAATGTAAGTGGTCAATCTTACATAATCGACGAGATAGGATAGTGTACTCCGTTTCATTTCATAAATCATTTTGACTTTTTTCTAATAAAA[A/T]
TTTTTAAAGTTTGATTGAGTTTATAGATAAAGTAGCATTTCCAACACAGAACAAACATATTACCAATGTATATTCATTGAATCTAATTTAGTGTTCTCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.50% 0.04% 0.00% NA
All Indica  2759 73.60% 26.40% 0.04% 0.00% NA
All Japonica  1512 28.20% 71.80% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 64.10% 35.70% 0.22% 0.00% NA
Indica III  913 62.50% 37.50% 0.00% 0.00% NA
Indica Intermediate  786 76.20% 23.80% 0.00% 0.00% NA
Temperate Japonica  767 7.70% 92.30% 0.00% 0.00% NA
Tropical Japonica  504 67.50% 32.50% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128560757 T -> A LOC_Os01g49690.1 downstream_gene_variant ; 58.0bp to feature; MODIFIER silent_mutation Average:77.658; most accessible tissue: Callus, score: 95.388 N N N N
vg0128560757 T -> A LOC_Os01g49690-LOC_Os01g49710 intergenic_region ; MODIFIER silent_mutation Average:77.658; most accessible tissue: Callus, score: 95.388 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128560757 NA 3.96E-09 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 5.43E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 4.13E-06 NA mr1596 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 6.80E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 1.68E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 1.65E-14 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 5.42E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 8.60E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 6.12E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 7.27E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 5.15E-07 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 6.67E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 6.55E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 4.56E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 1.23E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 9.14E-96 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 1.03E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 5.09E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128560757 NA 7.85E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251