\
| Variant ID: vg0128560757 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28560757 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAGAACACTAAATTAGATTCAATGAATATACATTGGTAATATGTTTGTTCTGTGTTGGAAATGCTACTTTATCTATAAACTCAATCAAACTTTAAAAA[T/A]
TTTTATTAGAAAAAAGTCAAAATGATTTATGAAATGAAACGGAGTACACTATCCTATCTCGTCGATTATGTAAGATTGACCACTTACATTCGGACACGTT
AACGTGTCCGAATGTAAGTGGTCAATCTTACATAATCGACGAGATAGGATAGTGTACTCCGTTTCATTTCATAAATCATTTTGACTTTTTTCTAATAAAA[A/T]
TTTTTAAAGTTTGATTGAGTTTATAGATAAAGTAGCATTTCCAACACAGAACAAACATATTACCAATGTATATTCATTGAATCTAATTTAGTGTTCTCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 73.60% | 26.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 28.20% | 71.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 64.10% | 35.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 7.70% | 92.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 67.50% | 32.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128560757 | T -> A | LOC_Os01g49690.1 | downstream_gene_variant ; 58.0bp to feature; MODIFIER | silent_mutation | Average:77.658; most accessible tissue: Callus, score: 95.388 | N | N | N | N |
| vg0128560757 | T -> A | LOC_Os01g49690-LOC_Os01g49710 | intergenic_region ; MODIFIER | silent_mutation | Average:77.658; most accessible tissue: Callus, score: 95.388 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128560757 | NA | 3.96E-09 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 5.43E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | 4.13E-06 | NA | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 6.80E-07 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 1.68E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 1.65E-14 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 5.42E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 8.60E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 6.12E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 7.27E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 5.15E-07 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 6.67E-07 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 6.55E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 4.56E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 1.23E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 9.14E-96 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 1.03E-22 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 5.09E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128560757 | NA | 7.85E-27 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |