Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0128531441:

Variant ID: vg0128531441 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28531441
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGGGTTAGGTTTTTCTTTTTTTTTTCTAGGGTAAAAAAATTCAAAGTTCTAAAATTCAAACAAAGAAAGAGACTTATTTTTCCAAAAGAGTAAATCT[A/G]
CATGGCTGCATCAAAGGCTATATGCGAGCTTGGAAAAACCTTTAGCTAGTTTATGGGCATCAGCATCCCTGGACTCTCCCCCTACCGGGCATTTGGGACA

Reverse complement sequence

TGTCCCAAATGCCCGGTAGGGGGAGAGTCCAGGGATGCTGATGCCCATAAACTAGCTAAAGGTTTTTCCAAGCTCGCATATAGCCTTTGATGCAGCCATG[T/C]
AGATTTACTCTTTTGGAAAAATAAGTCTCTTTCTTTGTTTGAATTTTAGAACTTTGAATTTTTTTACCCTAGAAAAAAAAAAGAAAAACCTAACCCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	25.30%	0.61%	46.78%	NA
All Indica	2759	27.60%	2.20%	0.87%	69.30%	NA
All Japonica	1512	9.90%	72.20%	0.20%	17.66%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	45.00%	1.70%	0.67%	52.61%	NA
Indica II	465	1.30%	3.90%	0.86%	93.98%	NA
Indica III	913	29.00%	1.80%	0.77%	68.46%	NA
Indica Intermediate	786	28.20%	2.30%	1.15%	68.32%	NA
Temperate Japonica	767	6.80%	92.70%	0.13%	0.39%	NA
Tropical Japonica	504	17.70%	33.30%	0.40%	48.61%	NA
Japonica Intermediate	241	3.70%	88.40%	0.00%	7.88%	NA
VI/Aromatic	96	83.30%	13.50%	0.00%	3.12%	NA
Intermediate	90	36.70%	28.90%	2.22%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128531441	A -> G	LOC_Os01g49630.1	upstream_gene_variant ; 3380.0bp to feature; MODIFIER	silent_mutation	Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0128531441	A -> G	LOC_Os01g49614.2	downstream_gene_variant ; 3957.0bp to feature; MODIFIER	silent_mutation	Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0128531441	A -> G	LOC_Os01g49614.1	intron_variant ; MODIFIER	silent_mutation	Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0128531441	A -> G	LOC_Os01g49614.3	intron_variant ; MODIFIER	silent_mutation	Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N
vg0128531441	A -> DEL	N	N	silent_mutation	Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128531441	NA	7.13E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	3.71E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	7.73E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	1.51E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	3.37E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	1.61E-06	mr1889	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	3.63E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	1.49E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	4.91E-06	4.68E-25	mr1698_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441	NA	2.06E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251