\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128531441:

Variant ID: vg0128531441 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28531441
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGGGTTAGGTTTTTCTTTTTTTTTTCTAGGGTAAAAAAATTCAAAGTTCTAAAATTCAAACAAAGAAAGAGACTTATTTTTCCAAAAGAGTAAATCT[A/G]
CATGGCTGCATCAAAGGCTATATGCGAGCTTGGAAAAACCTTTAGCTAGTTTATGGGCATCAGCATCCCTGGACTCTCCCCCTACCGGGCATTTGGGACA

Reverse complement sequence

TGTCCCAAATGCCCGGTAGGGGGAGAGTCCAGGGATGCTGATGCCCATAAACTAGCTAAAGGTTTTTCCAAGCTCGCATATAGCCTTTGATGCAGCCATG[T/C]
AGATTTACTCTTTTGGAAAAATAAGTCTCTTTCTTTGTTTGAATTTTAGAACTTTGAATTTTTTTACCCTAGAAAAAAAAAAGAAAAACCTAACCCTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.30% 25.30% 0.61% 46.78% NA
All Indica  2759 27.60% 2.20% 0.87% 69.30% NA
All Japonica  1512 9.90% 72.20% 0.20% 17.66% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 45.00% 1.70% 0.67% 52.61% NA
Indica II  465 1.30% 3.90% 0.86% 93.98% NA
Indica III  913 29.00% 1.80% 0.77% 68.46% NA
Indica Intermediate  786 28.20% 2.30% 1.15% 68.32% NA
Temperate Japonica  767 6.80% 92.70% 0.13% 0.39% NA
Tropical Japonica  504 17.70% 33.30% 0.40% 48.61% NA
Japonica Intermediate  241 3.70% 88.40% 0.00% 7.88% NA
VI/Aromatic  96 83.30% 13.50% 0.00% 3.12% NA
Intermediate  90 36.70% 28.90% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128531441 A -> G LOC_Os01g49630.1 upstream_gene_variant ; 3380.0bp to feature; MODIFIER silent_mutation Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0128531441 A -> G LOC_Os01g49614.2 downstream_gene_variant ; 3957.0bp to feature; MODIFIER silent_mutation Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0128531441 A -> G LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0128531441 A -> G LOC_Os01g49614.3 intron_variant ; MODIFIER silent_mutation Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0128531441 A -> DEL N N silent_mutation Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128531441 NA 7.13E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 3.71E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 7.73E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 1.51E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 3.37E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 1.61E-06 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 3.63E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 1.49E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 4.91E-06 4.68E-25 mr1698_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531441 NA 2.06E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251