\
| Variant ID: vg0128531441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28531441 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 94. )
CAAAGGGTTAGGTTTTTCTTTTTTTTTTCTAGGGTAAAAAAATTCAAAGTTCTAAAATTCAAACAAAGAAAGAGACTTATTTTTCCAAAAGAGTAAATCT[A/G]
CATGGCTGCATCAAAGGCTATATGCGAGCTTGGAAAAACCTTTAGCTAGTTTATGGGCATCAGCATCCCTGGACTCTCCCCCTACCGGGCATTTGGGACA
TGTCCCAAATGCCCGGTAGGGGGAGAGTCCAGGGATGCTGATGCCCATAAACTAGCTAAAGGTTTTTCCAAGCTCGCATATAGCCTTTGATGCAGCCATG[T/C]
AGATTTACTCTTTTGGAAAAATAAGTCTCTTTCTTTGTTTGAATTTTAGAACTTTGAATTTTTTTACCCTAGAAAAAAAAAAGAAAAACCTAACCCTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.30% | 25.30% | 0.61% | 46.78% | NA |
| All Indica | 2759 | 27.60% | 2.20% | 0.87% | 69.30% | NA |
| All Japonica | 1512 | 9.90% | 72.20% | 0.20% | 17.66% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.00% | 1.70% | 0.67% | 52.61% | NA |
| Indica II | 465 | 1.30% | 3.90% | 0.86% | 93.98% | NA |
| Indica III | 913 | 29.00% | 1.80% | 0.77% | 68.46% | NA |
| Indica Intermediate | 786 | 28.20% | 2.30% | 1.15% | 68.32% | NA |
| Temperate Japonica | 767 | 6.80% | 92.70% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 17.70% | 33.30% | 0.40% | 48.61% | NA |
| Japonica Intermediate | 241 | 3.70% | 88.40% | 0.00% | 7.88% | NA |
| VI/Aromatic | 96 | 83.30% | 13.50% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 36.70% | 28.90% | 2.22% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128531441 | A -> G | LOC_Os01g49630.1 | upstream_gene_variant ; 3380.0bp to feature; MODIFIER | silent_mutation | Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0128531441 | A -> G | LOC_Os01g49614.2 | downstream_gene_variant ; 3957.0bp to feature; MODIFIER | silent_mutation | Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0128531441 | A -> G | LOC_Os01g49614.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0128531441 | A -> G | LOC_Os01g49614.3 | intron_variant ; MODIFIER | silent_mutation | Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0128531441 | A -> DEL | N | N | silent_mutation | Average:51.986; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128531441 | NA | 7.13E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 3.71E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 7.73E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 1.51E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 3.37E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 1.61E-06 | mr1889 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 3.63E-15 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 1.49E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | 4.91E-06 | 4.68E-25 | mr1698_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128531441 | NA | 2.06E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |