\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128527221:

Variant ID: vg0128527221 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28527221
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTGTGCTCTAATGGGAAGGTGAGCACCAAGGATTGCAGAAACAGCGGTGTCAGCAACTCGTCTACATTAAGTAAGTCCAGCAAATTTGTTTTTTTA[T/G]
AACTTTGTAACAATACCAAACCAACTAGTAGTCACTTATTTGAAATTGAGATTTGCTTCGGTCCAACAAAAAACATCTCGAGGTACTGGTATCTTACGGT

Reverse complement sequence

ACCGTAAGATACCAGTACCTCGAGATGTTTTTTGTTGGACCGAAGCAAATCTCAATTTCAAATAAGTGACTACTAGTTGGTTTGGTATTGTTACAAAGTT[A/C]
TAAAAAAACAAATTTGCTGGACTTACTTAATGTAGACGAGTTGCTGACACCGCTGTTTCTGCAATCCTTGGTGCTCACCTTCCCATTAGAGCACAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 8.10% 1.93% 43.86% NA
All Indica  2759 26.70% 1.80% 0.72% 70.82% NA
All Japonica  1512 81.90% 7.50% 4.23% 6.35% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 45.50% 0.00% 0.17% 54.29% NA
Indica II  465 5.60% 1.50% 0.65% 92.26% NA
Indica III  913 24.50% 1.50% 0.44% 73.49% NA
Indica Intermediate  786 27.40% 3.60% 1.53% 67.56% NA
Temperate Japonica  767 99.50% 0.00% 0.00% 0.52% NA
Tropical Japonica  504 50.60% 20.20% 12.30% 16.87% NA
Japonica Intermediate  241 91.30% 5.00% 0.83% 2.90% NA
VI/Aromatic  96 86.50% 10.40% 0.00% 3.12% NA
Intermediate  90 57.80% 12.20% 7.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128527221 T -> G LOC_Os01g49614.2 3_prime_UTR_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:52.643; most accessible tissue: Callus, score: 87.311 N N N N
vg0128527221 T -> G LOC_Os01g49600.1 downstream_gene_variant ; 3473.0bp to feature; MODIFIER silent_mutation Average:52.643; most accessible tissue: Callus, score: 87.311 N N N N
vg0128527221 T -> G LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:52.643; most accessible tissue: Callus, score: 87.311 N N N N
vg0128527221 T -> G LOC_Os01g49614.3 intron_variant ; MODIFIER silent_mutation Average:52.643; most accessible tissue: Callus, score: 87.311 N N N N
vg0128527221 T -> DEL N N silent_mutation Average:52.643; most accessible tissue: Callus, score: 87.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128527221 NA 7.45E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128527221 NA 1.42E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.05E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.30E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.25E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.18E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 7.84E-06 mr1648 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 4.09E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 3.76E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 4.46E-08 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 5.69E-06 5.69E-06 mr1815 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 5.17E-09 mr1892 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 5.29E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.90E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 4.40E-10 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 2.83E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 3.50E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 2.53E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 2.17E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 6.32E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 2.39E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.25E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.63E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 5.99E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 5.10E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 9.04E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 3.12E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 3.26E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 2.14E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128527221 NA 1.15E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251