\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128496460:

Variant ID: vg0128496460 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28496460
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.41, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TGGATCCACGGTGTCATGAAGGACACGCTGCCGTGTATGGTTTTTAGCTTGACTTCAATGCTAATCACTAAATTAGCCTTGATTGATTAGTTAAATCCGA[C/T]
ATTTTTATATGTCGCCCTCCAGAAGATCCTTTTTTATATATAGAACTGAGCACGAGTGCATTTCGCCGTTGGGGATTAGATATCACCGTCGAACGGCACA

Reverse complement sequence

TGTGCCGTTCGACGGTGATATCTAATCCCCAACGGCGAAATGCACTCGTGCTCAGTTCTATATATAAAAAAGGATCTTCTGGAGGGCGACATATAAAAAT[G/A]
TCGGATTTAACTAATCAATCAAGGCTAATTTAGTGATTAGCATTGAAGTCAAGCTAAAAACCATACACGGCAGCGTGTCCTTCATGACACCGTGGATCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 24.60% 1.10% 0.00% NA
All Indica  2759 99.00% 0.80% 0.14% 0.00% NA
All Japonica  1512 24.90% 72.20% 2.91% 0.00% NA
Aus  269 95.20% 3.70% 1.12% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 1.40% 93.00% 5.61% 0.00% NA
Tropical Japonica  504 67.30% 32.50% 0.20% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128496460 C -> T LOC_Os01g49529.1 upstream_gene_variant ; 193.0bp to feature; MODIFIER silent_mutation Average:74.256; most accessible tissue: Callus, score: 98.673 N N N N
vg0128496460 C -> T LOC_Os01g49550.1 upstream_gene_variant ; 2163.0bp to feature; MODIFIER silent_mutation Average:74.256; most accessible tissue: Callus, score: 98.673 N N N N
vg0128496460 C -> T LOC_Os01g49529.4 upstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:74.256; most accessible tissue: Callus, score: 98.673 N N N N
vg0128496460 C -> T LOC_Os01g49529-LOC_Os01g49550 intergenic_region ; MODIFIER silent_mutation Average:74.256; most accessible tissue: Callus, score: 98.673 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128496460 C T 0.04 0.05 0.06 0.04 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128496460 NA 1.71E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128496460 NA 5.18E-93 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 6.59E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.43E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.44E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 9.53E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 9.41E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 2.82E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 2.98E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 4.78E-35 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.95E-25 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.20E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 2.44E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 9.41E-06 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.07E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 1.25E-09 3.01E-117 mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.19E-15 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 3.85E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 2.76E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.47E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 3.03E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 4.21E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 4.67E-42 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.36E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 1.25E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 7.40E-07 2.22E-60 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128496460 NA 3.16E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251