\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128495725:

Variant ID: vg0128495725 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28495725
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCCTGGATCCATTGGTGGTAGTGGTACAAGGTTGCAGCCGAAGAAGAAGGTGAGGTTGTCACGGGGGCCGGTGTACTGAAGCCACTCATCGGCCTGGG[A/C]
GAAGGTGATGTTGTGGCGCACTCTGGGGCAGCTGCCGCCGCGGAGCGCATCGGTGTCTACGAGCACGATGGTGCGACTGTCGTAGATGATCTCCAGGATA

Reverse complement sequence

TATCCTGGAGATCATCTACGACAGTCGCACCATCGTGCTCGTAGACACCGATGCGCTCCGCGGCGGCAGCTGCCCCAGAGTGCGCCACAACATCACCTTC[T/G]
CCCAGGCCGATGAGTGGCTTCAGTACACCGGCCCCCGTGACAACCTCACCTTCTTCTTCGGCTGCAACCTTGTACCACTACCACCAATGGATCCAGGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 21.10% 7.62% 13.54% NA
All Indica  2759 79.10% 0.60% 6.42% 13.85% NA
All Japonica  1512 25.50% 62.60% 7.80% 4.17% NA
Aus  269 16.40% 0.70% 18.22% 64.68% NA
Indica I  595 66.10% 0.80% 13.45% 19.66% NA
Indica II  465 96.60% 0.60% 0.65% 2.15% NA
Indica III  913 81.80% 0.20% 3.83% 14.13% NA
Indica Intermediate  786 75.60% 0.90% 7.51% 16.03% NA
Temperate Japonica  767 5.00% 78.90% 9.91% 6.26% NA
Tropical Japonica  504 60.50% 31.50% 5.16% 2.78% NA
Japonica Intermediate  241 17.40% 75.50% 6.64% 0.41% NA
VI/Aromatic  96 67.70% 13.50% 7.29% 11.46% NA
Intermediate  90 56.70% 22.20% 10.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128495725 A -> DEL LOC_Os01g49529.4 N frameshift_variant Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 N N N N
vg0128495725 A -> DEL LOC_Os01g49529.1 N frameshift_variant Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 N N N N
vg0128495725 A -> C LOC_Os01g49529.1 missense_variant ; p.Ser138Ala; MODERATE nonsynonymous_codon ; S138G Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 possibly damaging -1.688 TOLERATED 0.62
vg0128495725 A -> C LOC_Os01g49529.1 missense_variant ; p.Ser138Ala; MODERATE nonsynonymous_codon ; S138A Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 benign -1.232 TOLERATED 0.78
vg0128495725 A -> C LOC_Os01g49529.4 missense_variant ; p.Ser138Ala; MODERATE nonsynonymous_codon ; S138G Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 possibly damaging -1.571 TOLERATED 0.91
vg0128495725 A -> C LOC_Os01g49529.4 missense_variant ; p.Ser138Ala; MODERATE nonsynonymous_codon ; S138A Average:90.666; most accessible tissue: Minghui63 flower, score: 96.687 benign -1.115 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128495725 A C 0.02 0.02 0.02 0.03 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128495725 NA 1.30E-33 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128495725 NA 1.71E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128495725 NA 7.45E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 2.73E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 3.40E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 1.14E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 1.24E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 2.70E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 1.32E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 7.50E-08 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 2.57E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 1.35E-09 mr1807_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 1.31E-53 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128495725 NA 3.34E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251