\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128353459:

Variant ID: vg0128353459 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28353459
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTCTGATGTATAAATCTTTTATGTATTTTTTTAGTTAATTGAATCCATGCCTTTAAAAATTTACCAATTTAAAAAAATAACACTACTATTCGCGATAT[T/C]
GGGTGTATACCACTGGAAATTTGTAAAATTCGAACTGTGCCACTCCATCACGATTTCTATCAACACATCCGTCAGCTCCAACTCCGGCAACAGCCTACGT

Reverse complement sequence

ACGTAGGCTGTTGCCGGAGTTGGAGCTGACGGATGTGTTGATAGAAATCGTGATGGAGTGGCACAGTTCGAATTTTACAAATTTCCAGTGGTATACACCC[A/G]
ATATCGCGAATAGTAGTGTTATTTTTTTAAATTGGTAAATTTTTAAAGGCATGGATTCAATTAACTAAAAAAATACATAAAAGATTTATACATCAGACCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.10% 0.02% 0.00% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 6.90% 93.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 18.10% 81.90% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128353459 T -> C LOC_Os01g49310.1 downstream_gene_variant ; 2409.0bp to feature; MODIFIER silent_mutation Average:73.873; most accessible tissue: Callus, score: 89.176 N N N N
vg0128353459 T -> C LOC_Os01g49320.1 downstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:73.873; most accessible tissue: Callus, score: 89.176 N N N N
vg0128353459 T -> C LOC_Os01g49310.2 downstream_gene_variant ; 2425.0bp to feature; MODIFIER silent_mutation Average:73.873; most accessible tissue: Callus, score: 89.176 N N N N
vg0128353459 T -> C LOC_Os01g49310-LOC_Os01g49320 intergenic_region ; MODIFIER silent_mutation Average:73.873; most accessible tissue: Callus, score: 89.176 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128353459 NA 2.52E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128353459 NA 1.75E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 1.70E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 6.95E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 1.33E-36 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 3.45E-27 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 5.12E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 1.68E-55 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 4.72E-42 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 5.36E-94 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 9.03E-28 mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 8.42E-31 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 9.02E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 8.12E-61 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 1.25E-43 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 5.15E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128353459 NA 7.29E-55 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251