\
| Variant ID: vg0128353459 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28353459 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )
CGGTCTGATGTATAAATCTTTTATGTATTTTTTTAGTTAATTGAATCCATGCCTTTAAAAATTTACCAATTTAAAAAAATAACACTACTATTCGCGATAT[T/C]
GGGTGTATACCACTGGAAATTTGTAAAATTCGAACTGTGCCACTCCATCACGATTTCTATCAACACATCCGTCAGCTCCAACTCCGGCAACAGCCTACGT
ACGTAGGCTGTTGCCGGAGTTGGAGCTGACGGATGTGTTGATAGAAATCGTGATGGAGTGGCACAGTTCGAATTTTACAAATTTCCAGTGGTATACACCC[A/G]
ATATCGCGAATAGTAGTGTTATTTTTTTAAATTGGTAAATTTTTAAAGGCATGGATTCAATTAACTAAAAAAATACATAAAAGATTTATACATCAGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 18.10% | 81.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128353459 | T -> C | LOC_Os01g49310.1 | downstream_gene_variant ; 2409.0bp to feature; MODIFIER | silent_mutation | Average:73.873; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0128353459 | T -> C | LOC_Os01g49320.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:73.873; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0128353459 | T -> C | LOC_Os01g49310.2 | downstream_gene_variant ; 2425.0bp to feature; MODIFIER | silent_mutation | Average:73.873; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| vg0128353459 | T -> C | LOC_Os01g49310-LOC_Os01g49320 | intergenic_region ; MODIFIER | silent_mutation | Average:73.873; most accessible tissue: Callus, score: 89.176 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128353459 | NA | 2.52E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0128353459 | NA | 1.75E-31 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 1.70E-27 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 6.95E-85 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 1.33E-36 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 3.45E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 5.12E-24 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 1.68E-55 | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 4.72E-42 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 5.36E-94 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 9.03E-28 | mr1403_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 8.42E-31 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 9.02E-46 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 8.12E-61 | mr1599_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 1.25E-43 | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 5.15E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128353459 | NA | 7.29E-55 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |