\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128344213:

Variant ID: vg0128344213 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 28344213
Reference Allele: TAAlternative Allele: AA,GA,T,TAA
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGTGCCGTGCTGAAAGGCCCATTTAGGCTGCGTTCTTATCAACTCTCCCTCTCGTTTTCCGCGCGCAAGCTTTTAAACTATTAAACGGTGTATTTTTT[TA/AA,GA,T,TAA]
AAAAAAGTTTATATATGAAAGTTGCTTAAAAAAATCATATTAATCCATTTTTTTTTAAAAAAATAGCTAATACTCCTTCCGTCGTAAAGGAAGTCGTTTA

Reverse complement sequence

TAAACGACTTCCTTTACGACGGAAGGAGTATTAGCTATTTTTTTAAAAAAAAATGGATTAATATGATTTTTTTAAGCAACTTTCATATATAAACTTTTTT[TA/TT,TC,A,TTA]
AAAAAATACACCGTTTAATAGTTTAAAAGCTTGCGCGCGGAAAACGAGAGGGAGAGTTGATAAGAACGCAGCCTAAATGGGCCTTTCAGCACGGCACGGC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 37.70% 0.85% 0.00% GA: 0.02%; T: 0.02%
All Indica  2759 42.00% 56.70% 1.27% 0.00% NA
All Japonica  1512 93.80% 6.20% 0.00% 0.00% NA
Aus  269 59.90% 38.30% 1.12% 0.00% T: 0.37%; GA: 0.37%
Indica I  595 27.10% 69.70% 3.19% 0.00% NA
Indica II  465 35.90% 63.90% 0.22% 0.00% NA
Indica III  913 55.40% 43.90% 0.66% 0.00% NA
Indica Intermediate  786 41.30% 57.50% 1.15% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 82.50% 17.50% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128344213 TA -> TAA LOC_Os01g49310.1 upstream_gene_variant ; 1627.0bp to feature; MODIFIER N Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> TAA LOC_Os01g49310.2 upstream_gene_variant ; 1627.0bp to feature; MODIFIER N Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> TAA LOC_Os01g49300.1 downstream_gene_variant ; 1742.0bp to feature; MODIFIER N Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> TAA LOC_Os01g49300-LOC_Os01g49310 intergenic_region ; MODIFIER N Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> AA LOC_Os01g49310.1 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> AA LOC_Os01g49310.2 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> AA LOC_Os01g49300.1 downstream_gene_variant ; 1740.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> AA LOC_Os01g49300-LOC_Os01g49310 intergenic_region ; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> T LOC_Os01g49310.1 upstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> T LOC_Os01g49310.2 upstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> T LOC_Os01g49300.1 downstream_gene_variant ; 1741.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> T LOC_Os01g49300-LOC_Os01g49310 intergenic_region ; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> GA LOC_Os01g49310.1 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> GA LOC_Os01g49310.2 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> GA LOC_Os01g49300.1 downstream_gene_variant ; 1740.0bp to feature; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N
vg0128344213 TA -> GA LOC_Os01g49300-LOC_Os01g49310 intergenic_region ; MODIFIER silent_mutation Average:96.257; most accessible tissue: Callus, score: 99.313 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128344213 TA AA -0.01 -0.01 -0.02 -0.02 -0.01 -0.02
vg0128344213 TA GA -0.03 -0.02 -0.02 -0.03 -0.02 -0.03
vg0128344213 TA T -0.01 -0.02 0.01 0.01 0.01 0.0
vg0128344213 TA TAA 0.01 0.0 0.01 0.04 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128344213 NA 1.68E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128344213 NA 4.99E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128344213 NA 5.71E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128344213 2.28E-07 1.52E-09 mr1227 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128344213 NA 9.49E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128344213 NA 7.73E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251