\
| Variant ID: vg0128212865 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28212865 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 250. )
CGTTGGAGAGTTTGTTCCCACTTTTTTGTGGTTTTGTTCCAAGTTAATCTAGAGAGTTTGTTTCATTGTTATTGTTTACTAAAATTATTTAGTTACCACG[G/A]
CTGATATGCTTACCGACCTTATGGAGATCGCATCTCACTATGAGCAGCTTTTGTGAGAGAGAGAGACAGAGAAAAAAGGAGTAGATCGACCAAGATGATC
GATCATCTTGGTCGATCTACTCCTTTTTTCTCTGTCTCTCTCTCTCACAAAAGCTGCTCATAGTGAGATGCGATCTCCATAAGGTCGGTAAGCATATCAG[C/T]
CGTGGTAACTAAATAATTTTAGTAAACAATAACAATGAAACAAACTCTCTAGATTAACTTGGAACAAAACCACAAAAAAGTGGGAACAAACTCTCCAACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.30% | 29.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.90% | 68.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128212865 | G -> A | LOC_Os01g49080.1 | downstream_gene_variant ; 1911.0bp to feature; MODIFIER | silent_mutation | Average:23.975; most accessible tissue: Callus, score: 43.589 | N | N | N | N |
| vg0128212865 | G -> A | LOC_Os01g49080-LOC_Os01g49090 | intergenic_region ; MODIFIER | silent_mutation | Average:23.975; most accessible tissue: Callus, score: 43.589 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128212865 | NA | 3.36E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 2.80E-87 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 8.98E-27 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 3.16E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 8.34E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | 9.03E-07 | 7.31E-30 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 1.54E-08 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 3.15E-16 | mr1277_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 1.95E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 1.40E-99 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 2.18E-45 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 4.37E-49 | mr1805_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 6.75E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128212865 | NA | 7.68E-56 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |