\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128147669:

Variant ID: vg0128147669 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28147669
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GATCGGTTTGCCCCCCCCCTTCCCCCTATACTCCTCCCTCTTCTCCCCCTTTCTCCTCCCCTTCTTCTCTTTCTACTACAGTACACTACACAATTTTTTT[T/A]
AAAAAAACAAAAGTTAAAAAAATTTATGTATAGAAATACTATTATATAAAAAATTTGAATTCAAATTCAAATTTGAATCGGGTATGTAAACTTTTGACTT

Reverse complement sequence

AAGTCAAAAGTTTACATACCCGATTCAAATTTGAATTTGAATTCAAATTTTTTATATAATAGTATTTCTATACATAAATTTTTTTAACTTTTGTTTTTTT[A/T]
AAAAAAATTGTGTAGTGTACTGTAGTAGAAAGAGAAGAAGGGGAGGAGAAAGGGGGAGAAGAGGGAGGAGTATAGGGGGAAGGGGGGGGGCAAACCGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 25.30% 18.54% 12.70% NA
All Indica  2759 29.40% 26.00% 24.39% 20.19% NA
All Japonica  1512 78.10% 8.70% 10.91% 2.25% NA
Aus  269 2.20% 89.60% 6.32% 1.86% NA
Indica I  595 35.80% 18.70% 28.24% 17.31% NA
Indica II  465 58.30% 12.70% 20.43% 8.60% NA
Indica III  913 5.50% 38.60% 24.21% 31.76% NA
Indica Intermediate  786 35.20% 24.90% 24.05% 15.78% NA
Temperate Japonica  767 86.00% 0.40% 12.13% 1.43% NA
Tropical Japonica  504 62.50% 22.80% 10.71% 3.97% NA
Japonica Intermediate  241 85.50% 5.80% 7.47% 1.24% NA
VI/Aromatic  96 14.60% 83.30% 2.08% 0.00% NA
Intermediate  90 47.80% 26.70% 21.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128147669 T -> A LOC_Os01g49000.1 downstream_gene_variant ; 4309.0bp to feature; MODIFIER silent_mutation Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0128147669 T -> A LOC_Os01g49000-LOC_Os01g49010 intergenic_region ; MODIFIER silent_mutation Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0128147669 T -> DEL N N silent_mutation Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128147669 NA 9.41E-06 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 5.78E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.26E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 6.16E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.86E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.71E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 6.16E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 2.17E-16 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 2.29E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 4.40E-07 mr1331_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 8.13E-06 8.13E-06 mr1342_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.14E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 8.27E-07 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.50E-07 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 7.48E-11 mr1550_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 4.17E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 2.20E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 1.07E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 6.13E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669 NA 7.00E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251