Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128147669:

Variant ID: vg0128147669 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28147669
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GATCGGTTTGCCCCCCCCCTTCCCCCTATACTCCTCCCTCTTCTCCCCCTTTCTCCTCCCCTTCTTCTCTTTCTACTACAGTACACTACACAATTTTTTT[T/A]
AAAAAAACAAAAGTTAAAAAAATTTATGTATAGAAATACTATTATATAAAAAATTTGAATTCAAATTCAAATTTGAATCGGGTATGTAAACTTTTGACTT

Reverse complement sequence

AAGTCAAAAGTTTACATACCCGATTCAAATTTGAATTTGAATTCAAATTTTTTATATAATAGTATTTCTATACATAAATTTTTTTAACTTTTGTTTTTTT[A/T]
AAAAAAATTGTGTAGTGTACTGTAGTAGAAAGAGAAGAAGGGGAGGAGAAAGGGGGAGAAGAGGGAGGAGTATAGGGGGAAGGGGGGGGGCAAACCGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	25.30%	18.54%	12.70%	NA
All Indica	2759	29.40%	26.00%	24.39%	20.19%	NA
All Japonica	1512	78.10%	8.70%	10.91%	2.25%	NA
Aus	269	2.20%	89.60%	6.32%	1.86%	NA
Indica I	595	35.80%	18.70%	28.24%	17.31%	NA
Indica II	465	58.30%	12.70%	20.43%	8.60%	NA
Indica III	913	5.50%	38.60%	24.21%	31.76%	NA
Indica Intermediate	786	35.20%	24.90%	24.05%	15.78%	NA
Temperate Japonica	767	86.00%	0.40%	12.13%	1.43%	NA
Tropical Japonica	504	62.50%	22.80%	10.71%	3.97%	NA
Japonica Intermediate	241	85.50%	5.80%	7.47%	1.24%	NA
VI/Aromatic	96	14.60%	83.30%	2.08%	0.00%	NA
Intermediate	90	47.80%	26.70%	21.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128147669	T -> A	LOC_Os01g49000.1	downstream_gene_variant ; 4309.0bp to feature; MODIFIER	silent_mutation	Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0128147669	T -> A	LOC_Os01g49000-LOC_Os01g49010	intergenic_region ; MODIFIER	silent_mutation	Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0128147669	T -> DEL	N	N	silent_mutation	Average:34.569; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128147669	NA	9.41E-06	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	5.78E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.26E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	6.16E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.86E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.71E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	6.16E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	2.17E-16	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	2.29E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	4.40E-07	mr1331_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	8.13E-06	8.13E-06	mr1342_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.14E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	8.27E-07	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.50E-07	mr1442_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	7.48E-11	mr1550_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	4.17E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	2.20E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	1.07E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	6.13E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147669	NA	7.00E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251