\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128089631:

Variant ID: vg0128089631 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 28089631
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: AASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCTAGCCATACGTTGCGGATAATTGTACTATGGCGTTGGCCAGGGCTTGGGCCGCCGTTTGTGTGGTGTCGTCATTTGTATGATATTTAAATAGTTAT[GA/AA,G]
AAAAATAAAAAAATTAACTAAATAGATTAATATGTGATAGATTTATTCTATAAATATGCAAGTTAAAAATTCAACTTCTTCAAGTTAAAATAAACAAATT

Reverse complement sequence

AATTTGTTTATTTTAACTTGAAGAAGTTGAATTTTTAACTTGCATATTTATAGAATAAATCTATCACATATTAATCTATTTAGTTAATTTTTTTATTTTT[TC/TT,C]
ATAACTATTTAAATATCATACAAATGACGACACCACACAAACGGCGGCCCAAGCCCTGGCCAACGCCATAGTACAATTATCCGCAACGTATGGCTAGCTC

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 31.50% 0.63% 7.22% G: 0.06%
All Indica  2759 97.10% 1.30% 0.40% 1.20% NA
All Japonica  1512 8.60% 90.90% 0.07% 0.46% NA
Aus  269 5.60% 9.30% 3.72% 80.67% G: 0.74%
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 97.80% 0.30% 0.55% 1.31% NA
Indica Intermediate  786 94.40% 2.40% 0.51% 2.67% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 23.40% 76.20% 0.20% 0.20% NA
Japonica Intermediate  241 3.30% 94.20% 0.00% 2.49% NA
VI/Aromatic  96 3.10% 13.50% 7.29% 76.04% NA
Intermediate  90 37.80% 47.80% 1.11% 12.22% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128089631 GA -> G LOC_Os01g48940.1 upstream_gene_variant ; 3223.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> G LOC_Os01g48950.1 upstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> G LOC_Os01g48960.1 downstream_gene_variant ; 1576.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> G LOC_Os01g48950-LOC_Os01g48960 intergenic_region ; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> AA LOC_Os01g48940.1 upstream_gene_variant ; 3222.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> AA LOC_Os01g48950.1 upstream_gene_variant ; 525.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> AA LOC_Os01g48960.1 downstream_gene_variant ; 1577.0bp to feature; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> AA LOC_Os01g48950-LOC_Os01g48960 intergenic_region ; MODIFIER silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N
vg0128089631 GA -> DEL N N silent_mutation Average:82.001; most accessible tissue: Zhenshan97 flag leaf, score: 89.942 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128089631 GA AA 0.04 0.03 0.02 0.02 0.02 0.01
vg0128089631 GA G -0.01 -0.01 0.08 -0.01 -0.03 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128089631 NA 6.51E-17 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 1.06E-14 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 6.40E-21 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.33E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 6.08E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 7.16E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 2.82E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.39E-49 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 4.50E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.06E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 1.06E-26 mr1862 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.41E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.64E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 2.19E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 7.26E-38 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 9.30E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 7.13E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 7.66E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 1.07E-24 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 5.46E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.36E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 3.64E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128089631 NA 1.22E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251