\
| Variant ID: vg0127881125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27881125 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )
TAGTTTCTTCTCTGAAAAAATAAATTACAACAAAATAAATAATATTTTTATTTTTTTAATAGGATAAATGATTAGAATTACTATTGGGAGCTCCAAGCGC[G/C]
AAACGTGTATCAGCCAGGCCCACCTCACCCCACGTTCCATCATCTCGCTCCCACCGTTATCGGAGTAAACGATTTACTTAGATAAAAACAGCTTCTCTGG
CCAGAGAAGCTGTTTTTATCTAAGTAAATCGTTTACTCCGATAACGGTGGGAGCGAGATGATGGAACGTGGGGTGAGGTGGGCCTGGCTGATACACGTTT[C/G]
GCGCTTGGAGCTCCCAATAGTAATTCTAATCATTTATCCTATTAAAAAAATAAAAATATTATTTATTTTGTTGTAATTTATTTTTTCAGAGAAGAAACTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.20% | 21.80% | 2.71% | 46.30% | NA |
| All Indica | 2759 | 1.30% | 16.20% | 4.60% | 77.85% | NA |
| All Japonica | 1512 | 86.30% | 13.30% | 0.00% | 0.40% | NA |
| Aus | 269 | 0.40% | 96.70% | 0.37% | 2.60% | NA |
| Indica I | 595 | 0.70% | 17.10% | 3.87% | 78.32% | NA |
| Indica II | 465 | 2.80% | 3.20% | 6.02% | 87.96% | NA |
| Indica III | 913 | 0.40% | 25.60% | 3.50% | 70.43% | NA |
| Indica Intermediate | 786 | 1.90% | 12.30% | 5.60% | 80.15% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 62.10% | 37.50% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 2.10% | 94.80% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 41.10% | 32.20% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127881125 | G -> DEL | N | N | silent_mutation | Average:37.252; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0127881125 | G -> C | LOC_Os01g48640.1 | upstream_gene_variant ; 1895.0bp to feature; MODIFIER | silent_mutation | Average:37.252; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0127881125 | G -> C | LOC_Os01g48620.1 | downstream_gene_variant ; 2665.0bp to feature; MODIFIER | silent_mutation | Average:37.252; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| vg0127881125 | G -> C | LOC_Os01g48620-LOC_Os01g48640 | intergenic_region ; MODIFIER | silent_mutation | Average:37.252; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127881125 | NA | 8.63E-58 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 5.21E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 5.20E-06 | NA | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 1.23E-08 | NA | mr1103_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 1.91E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 2.76E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 2.17E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 1.33E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 5.07E-06 | NA | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 8.92E-53 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 3.35E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 1.92E-20 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | 5.94E-06 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 8.64E-28 | mr1584_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 7.33E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 8.46E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 3.24E-18 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127881125 | NA | 8.71E-20 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |