Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127819685:

Variant ID: vg0127819685 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27819685
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

GCGAGAGTCGGCTCTGATACCATTTTGTAACGTCCCGCCTTCCCCCAGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACA[G/A,T]
ACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCGTGTGCACCTGGAAAGAATTTCCCGGTCAGTCACCCATCCCAAATTGCTCCAGGCCAAGCAC

Reverse complement sequence

GTGCTTGGCCTGGAGCAATTTGGGATGGGTGACTGACCGGGAAATTCTTTCCAGGTGCACACGAGTGAGGACAAAGTGTGCAGAAAAGACATGTGTTGGT[C/T,A]
TGTGAGGGCAGTCTATGACCTATGAAAGCTATCAGATGTAAGTGGGCCCGGCCTGGGGGAAGGCGGGACGTTACAAAATGGTATCAGAGCCGACTCTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	15.70%	0.99%	0.30%	T: 0.02%
All Indica	2759	98.80%	0.80%	0.29%	0.07%	NA
All Japonica	1512	51.20%	45.70%	2.38%	0.73%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	97.20%	2.20%	0.43%	0.22%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.00%	0.38%	0.13%	NA
Temperate Japonica	767	77.60%	18.80%	3.13%	0.52%	NA
Tropical Japonica	504	14.70%	83.10%	1.39%	0.79%	NA
Japonica Intermediate	241	43.60%	53.10%	2.07%	1.24%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	62.20%	32.20%	3.33%	1.11%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127819685	G -> T	LOC_Os01g48520.1	downstream_gene_variant ; 133.0bp to feature; MODIFIER	silent_mutation	Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865	N	N	N	N
vg0127819685	G -> T	LOC_Os01g48500-LOC_Os01g48520	intergenic_region ; MODIFIER	silent_mutation	Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865	N	N	N	N
vg0127819685	G -> A	LOC_Os01g48520.1	downstream_gene_variant ; 133.0bp to feature; MODIFIER	silent_mutation	Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865	N	N	N	N
vg0127819685	G -> A	LOC_Os01g48500-LOC_Os01g48520	intergenic_region ; MODIFIER	silent_mutation	Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865	N	N	N	N
vg0127819685	G -> DEL	N	N	silent_mutation	Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127819685	NA	3.31E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	2.62E-12	mr1648	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	5.79E-07	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	6.16E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	5.13E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	3.21E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	2.85E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	3.39E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	2.67E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	9.16E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	4.94E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.72E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.47E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	5.37E-06	7.91E-07	mr1444_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	4.56E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	2.46E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	7.74E-07	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.28E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.92E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	9.97E-08	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.71E-06	mr1544_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	8.86E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.09E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	4.48E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	2.01E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	8.30E-09	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	3.49E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	4.47E-15	mr1761_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.15E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.21E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	1.65E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685	NA	5.24E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251