\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127819685:

Variant ID: vg0127819685 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27819685
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAGAGTCGGCTCTGATACCATTTTGTAACGTCCCGCCTTCCCCCAGGCCGGGCCCACTTACATCTGATAGCTTTCATAGGTCATAGACTGCCCTCACA[G/A,T]
ACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCGTGTGCACCTGGAAAGAATTTCCCGGTCAGTCACCCATCCCAAATTGCTCCAGGCCAAGCAC

Reverse complement sequence

GTGCTTGGCCTGGAGCAATTTGGGATGGGTGACTGACCGGGAAATTCTTTCCAGGTGCACACGAGTGAGGACAAAGTGTGCAGAAAAGACATGTGTTGGT[C/T,A]
TGTGAGGGCAGTCTATGACCTATGAAAGCTATCAGATGTAAGTGGGCCCGGCCTGGGGGAAGGCGGGACGTTACAAAATGGTATCAGAGCCGACTCTCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 15.70% 0.99% 0.30% T: 0.02%
All Indica  2759 98.80% 0.80% 0.29% 0.07% NA
All Japonica  1512 51.20% 45.70% 2.38% 0.73% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 97.20% 2.20% 0.43% 0.22% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.00% 0.38% 0.13% NA
Temperate Japonica  767 77.60% 18.80% 3.13% 0.52% NA
Tropical Japonica  504 14.70% 83.10% 1.39% 0.79% NA
Japonica Intermediate  241 43.60% 53.10% 2.07% 1.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 62.20% 32.20% 3.33% 1.11% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127819685 G -> T LOC_Os01g48520.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0127819685 G -> T LOC_Os01g48500-LOC_Os01g48520 intergenic_region ; MODIFIER silent_mutation Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0127819685 G -> A LOC_Os01g48520.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0127819685 G -> A LOC_Os01g48500-LOC_Os01g48520 intergenic_region ; MODIFIER silent_mutation Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N
vg0127819685 G -> DEL N N silent_mutation Average:49.011; most accessible tissue: Zhenshan97 flower, score: 62.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127819685 NA 3.31E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 2.62E-12 mr1648 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 5.79E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 6.16E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 5.13E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 3.21E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 2.85E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 3.39E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 2.67E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 9.16E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 4.94E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.72E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.47E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 5.37E-06 7.91E-07 mr1444_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 4.56E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 2.46E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 7.74E-07 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.28E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.92E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 9.97E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.71E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 8.86E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.09E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 4.48E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 2.01E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 8.30E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 3.49E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 4.47E-15 mr1761_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.15E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.21E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 1.65E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127819685 NA 5.24E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251