Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0127705431:

Variant ID: vg0127705431 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27705431
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.10, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AACGTAGTCTTCCAATATGATTTTCTATTATAATATATAGTAAATATATTTTTAATTTTATTAAAGCAGATTTTAGGACTAATCTATATATTCCTTCTGT[A/C]
AAAAAAAACAAGAGGGCAAACCTGACTATGAATCTGGATATTTGGACAGATGGAGTATGTTCTAGCGCACTATAATTGAATAGGCAGGTCAGATCAAATC

Reverse complement sequence

GATTTGATCTGACCTGCCTATTCAATTATAGTGCGCTAGAACATACTCCATCTGTCCAAATATCCAGATTCATAGTCAGGTTTGCCCTCTTGTTTTTTTT[T/G]
ACAGAAGGAATATATAGATTAGTCCTAAAATCTGCTTTAATAAAATTAAAAATATATTTACTATATATTATAATAGAAAATCATATTGGAAGACTACGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 32.40% 0.30% 2.60% NA
All Indica  2759 95.60% 1.20% 0.14% 3.12% NA
All Japonica  1512 2.00% 96.00% 0.00% 2.05% NA
Aus  269 96.30% 0.70% 2.60% 0.37% NA
Indica I  595 87.20% 0.50% 0.34% 11.93% NA
Indica II  465 96.60% 3.00% 0.22% 0.22% NA
Indica III  913 99.60% 0.20% 0.11% 0.11% NA
Indica Intermediate  786 96.70% 1.70% 0.00% 1.65% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 91.70% 0.00% 5.75% NA
Japonica Intermediate  241 3.70% 95.40% 0.00% 0.83% NA
VI/Aromatic  96 94.80% 2.10% 3.12% 0.00% NA
Intermediate  90 47.80% 46.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127705431 A -> DEL N N silent_mutation Average:72.173; most accessible tissue: Callus, score: 94.696 N N N N
vg0127705431 A -> C LOC_Os01g48330.1 upstream_gene_variant ; 2955.0bp to feature; MODIFIER silent_mutation Average:72.173; most accessible tissue: Callus, score: 94.696 N N N N
vg0127705431 A -> C LOC_Os01g48339.1 downstream_gene_variant ; 233.0bp to feature; MODIFIER silent_mutation Average:72.173; most accessible tissue: Callus, score: 94.696 N N N N
vg0127705431 A -> C LOC_Os01g48339-LOC_Os01g48360 intergenic_region ; MODIFIER silent_mutation Average:72.173; most accessible tissue: Callus, score: 94.696 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127705431 A C 0.04 0.0 -0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127705431 NA 1.53E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 3.37E-49 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 3.57E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 4.33E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 5.08E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 1.54E-31 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.11E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 7.29E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 1.19E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 5.90E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.19E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 4.45E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 4.27E-07 4.27E-07 mr1569_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.04E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 6.50E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 7.67E-13 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.71E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 1.37E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.37E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 6.50E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 6.41E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 7.03E-18 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 7.17E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 3.61E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 3.74E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.53E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 2.33E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 1.39E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127705431 NA 1.25E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251