\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127642064:

Variant ID: vg0127642064 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27642064
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGAAGTCCCACCAAACCACCAGCAGCTTTACCATTGTACTCCTCTACAACTCGCCTGCTGCCTCCCTTTCTTATTGTCATTGAGATTTTAAAATCGTA[C/T]
ATGATTATCATTGATTTTTTTTTACTTTTTAGAAGTTACGAACCTTTAAAAATTGGACTTGTAGTTTTATTTTTTTTATAATTTTTAGAAGTCCCATCAA

Reverse complement sequence

TTGATGGGACTTCTAAAAATTATAAAAAAAATAAAACTACAAGTCCAATTTTTAAAGGTTCGTAACTTCTAAAAAGTAAAAAAAAATCAATGATAATCAT[G/A]
TACGATTTTAAAATCTCAATGACAATAAGAAAGGGAGGCAGCAGGCGAGTTGTAGAGGAGTACAATGGTAAAGCTGCTGGTGGTTTGGTGGGACTTCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.10% 0.02% 0.00% NA
All Indica  2759 92.60% 7.30% 0.04% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 85.50% 14.50% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127642064 C -> T LOC_Os01g48220-LOC_Os01g48230 intergenic_region ; MODIFIER silent_mutation Average:34.537; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127642064 NA 1.03E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 2.90E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 5.17E-10 mr1126 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 8.92E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 4.16E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.78E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.57E-25 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 3.07E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 3.29E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.77E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.05E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 4.78E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.42E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 9.14E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.77E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.67E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.17E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 2.25E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 8.25E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 2.67E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.06E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.01E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 5.39E-09 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 3.19E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.11E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 1.97E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 4.27E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127642064 NA 2.49E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251