Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127208209:

Variant ID: vg0127208209 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 27208209
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GATCGATTAAAAACCCAATCACGACAAATATCATCCAGAGTTCGTATCAAATCTAACCCAAATTTCCTCCTAAACCCAATCATGTGAAAAAATCGGGTCT[T/A]
AAGAGACAACTTTATGGTATAAGACCGATTGAATCCAAGGAGAAAAAAAAAGAGAAATCGAGTCGGAGAAGGAGAAAATCACATATACACTCGATCCGGT

Reverse complement sequence

ACCGGATCGAGTGTATATGTGATTTTCTCCTTCTCCGACTCGATTTCTCTTTTTTTTTCTCCTTGGATTCAATCGGTCTTATACCATAAAGTTGTCTCTT[A/T]
AGACCCGATTTTTTCACATGATTGGGTTTAGGAGGAAATTTGGGTTAGATTTGATACGAACTCTGGATGATATTTGTCGTGATTGGGTTTTTAATCGATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	35.90%	1.12%	0.00%	NA
All Indica	2759	93.50%	5.40%	1.12%	0.00%	NA
All Japonica	1512	12.10%	87.20%	0.73%	0.00%	NA
Aus	269	64.30%	33.10%	2.60%	0.00%	NA
Indica I	595	96.60%	0.80%	2.52%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	90.10%	9.70%	0.11%	0.00%	NA
Indica Intermediate	786	93.10%	5.00%	1.91%	0.00%	NA
Temperate Japonica	767	1.20%	98.60%	0.26%	0.00%	NA
Tropical Japonica	504	24.20%	75.20%	0.60%	0.00%	NA
Japonica Intermediate	241	21.60%	75.90%	2.49%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	35.60%	60.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0127208209	T -> A	LOC_Os01g47560-LOC_Os01g47570	intergenic_region ; MODIFIER	silent_mutation	Average:22.022; most accessible tissue: Zhenshan97 flower, score: 29.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0127208209	NA	5.03E-06	mr1072_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	9.60E-06	mr1075_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	1.09E-53	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	1.04E-07	1.18E-27	mr1403_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	1.66E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	9.55E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	1.79E-26	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	2.11E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	2.31E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	1.68E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	1.20E-09	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	3.88E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	9.20E-10	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	2.66E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209	NA	2.10E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251