\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127208209:

Variant ID: vg0127208209 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27208209
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, T: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GATCGATTAAAAACCCAATCACGACAAATATCATCCAGAGTTCGTATCAAATCTAACCCAAATTTCCTCCTAAACCCAATCATGTGAAAAAATCGGGTCT[T/A]
AAGAGACAACTTTATGGTATAAGACCGATTGAATCCAAGGAGAAAAAAAAAGAGAAATCGAGTCGGAGAAGGAGAAAATCACATATACACTCGATCCGGT

Reverse complement sequence

ACCGGATCGAGTGTATATGTGATTTTCTCCTTCTCCGACTCGATTTCTCTTTTTTTTTCTCCTTGGATTCAATCGGTCTTATACCATAAAGTTGTCTCTT[A/T]
AGACCCGATTTTTTCACATGATTGGGTTTAGGAGGAAATTTGGGTTAGATTTGATACGAACTCTGGATGATATTTGTCGTGATTGGGTTTTTAATCGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 35.90% 1.12% 0.00% NA
All Indica  2759 93.50% 5.40% 1.12% 0.00% NA
All Japonica  1512 12.10% 87.20% 0.73% 0.00% NA
Aus  269 64.30% 33.10% 2.60% 0.00% NA
Indica I  595 96.60% 0.80% 2.52% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 90.10% 9.70% 0.11% 0.00% NA
Indica Intermediate  786 93.10% 5.00% 1.91% 0.00% NA
Temperate Japonica  767 1.20% 98.60% 0.26% 0.00% NA
Tropical Japonica  504 24.20% 75.20% 0.60% 0.00% NA
Japonica Intermediate  241 21.60% 75.90% 2.49% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 35.60% 60.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127208209 T -> A LOC_Os01g47560-LOC_Os01g47570 intergenic_region ; MODIFIER silent_mutation Average:22.022; most accessible tissue: Zhenshan97 flower, score: 29.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127208209 NA 5.03E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 9.60E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 1.09E-53 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 1.04E-07 1.18E-27 mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 1.66E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 9.55E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 1.79E-26 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 2.11E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 2.31E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 1.68E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 1.20E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 3.88E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 9.20E-10 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 2.66E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127208209 NA 2.10E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251