\
| Variant ID: vg0127206110 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27206110 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )
GGCTTAATTATGCATAAGACTTGATATACGGTGGGCCTCGCTGAGTCTGACATAATAATATTTTTCTATTCCGAATTTTAATCAATCCTGTCTTGTGTTC[G/T]
AAATGAGCTCCTCTTTCAATATTCCTTATTTTTATTTCAAATTTTGGTTATTTCTATATTTTATTCGACTTGAACTTTTATTTTTATTTTTATAATTTAG
CTAAATTATAAAAATAAAAATAAAAGTTCAAGTCGAATAAAATATAGAAATAACCAAAATTTGAAATAAAAATAAGGAATATTGAAAGAGGAGCTCATTT[C/A]
GAACACAAGACAGGATTGATTAAAATTCGGAATAGAAAAATATTATTATGTCAGACTCAGCGAGGCCCACCGTATATCAAGTCTTATGCATAATTAAGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 35.60% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 12.20% | 87.00% | 0.73% | 0.00% | NA |
| Aus | 269 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.70% | 9.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 24.20% | 75.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 22.40% | 75.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 57.80% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127206110 | G -> T | LOC_Os01g47560-LOC_Os01g47570 | intergenic_region ; MODIFIER | silent_mutation | Average:26.607; most accessible tissue: Zhenshan97 young leaf, score: 39.169 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127206110 | NA | 7.08E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 7.39E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 2.64E-54 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | 1.54E-06 | 1.90E-26 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | 4.45E-06 | NA | mr1469_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 3.01E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | 1.43E-06 | 3.30E-21 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 1.39E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 1.60E-26 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 6.78E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 3.20E-16 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 1.09E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 3.52E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | 4.77E-06 | 2.39E-10 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 1.19E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | 2.41E-06 | 1.93E-10 | mr1804_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 9.00E-15 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127206110 | NA | 5.09E-10 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |