\
| Variant ID: vg0126772523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26772523 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 109. )
GAAATTTCAGGGGTATAGAAGGGATCGGGCAAATTTCAAGGGTATGAAAGGGATTGAGTGAGTTTTCAAAGGTATACAGGGAATTTACTCTTTAAATTTA[A/G]
GCACTCATATCAGCCTTCTTACTCTAAAGTAGAGTAAAGCAAGCGAGTGGCATCCCTCTCTATTTTGTTTTAGCTCACTTCCAAGGATATACAGGGAATT
AATTCCCTGTATATCCTTGGAAGTGAGCTAAAACAAAATAGAGAGGGATGCCACTCGCTTGCTTTACTCTACTTTAGAGTAAGAAGGCTGATATGAGTGC[T/C]
TAAATTTAAAGAGTAAATTCCCTGTATACCTTTGAAAACTCACTCAATCCCTTTCATACCCTTGAAATTTGCCCGATCCCTTCTATACCCCTGAAATTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 37.90% | 12.53% | 0.00% | NA |
| All Indica | 2759 | 74.80% | 11.90% | 13.37% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 87.80% | 9.13% | 0.00% | NA |
| Aus | 269 | 71.70% | 11.50% | 16.73% | 0.00% | NA |
| Indica I | 595 | 66.20% | 10.60% | 23.19% | 0.00% | NA |
| Indica II | 465 | 74.60% | 13.30% | 12.04% | 0.00% | NA |
| Indica III | 913 | 79.20% | 12.80% | 8.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.20% | 10.80% | 12.98% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 92.60% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.80% | 80.00% | 14.29% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 88.80% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 54.20% | 28.12% | 0.00% | NA |
| Intermediate | 90 | 24.40% | 61.10% | 14.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126772523 | A -> G | LOC_Os01g46910.1 | upstream_gene_variant ; 3333.0bp to feature; MODIFIER | silent_mutation | Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0126772523 | A -> G | LOC_Os01g46920.1 | downstream_gene_variant ; 607.0bp to feature; MODIFIER | silent_mutation | Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| vg0126772523 | A -> G | LOC_Os01g46910-LOC_Os01g46920 | intergenic_region ; MODIFIER | silent_mutation | Average:47.575; most accessible tissue: Zhenshan97 flag leaf, score: 73.822 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126772523 | 4.20E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0126772523 | NA | 3.63E-26 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 2.77E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 4.79E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 7.61E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 7.80E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | 1.05E-07 | NA | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 1.35E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126772523 | NA | 1.44E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |