Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126648826:

Variant ID: vg0126648826 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26648826
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCGATGTGACGGAAAAGTTGAAAGTTTAAAGAAAAAACTAGCATGGTGGCCCGCGCAGATTGCGTGGTTAGCATCATTATATTTTATCTCATACAATAG[A/C,T]
ATATATGTTTTCTCATTATATTATTCAAATATATTAAAATGACAACATAATTATAAATTTTGCAATAACATTACAAAACTACTAATGTGTAATATTCATA

Reverse complement sequence

TATGAATATTACACATTAGTAGTTTTGTAATGTTATTGCAAAATTTATAATTATGTTGTCATTTTAATATATTTGAATAATATAATGAGAAAACATATAT[T/G,A]
CTATTGTATGAGATAAAATATAATGATGCTAACCACGCAATCTGCGCGGGCCACCATGCTAGTTTTTTCTTTAAACTTTCAACTTTTCCGTCACATCGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	11.00%	0.06%	0.00%	T: 0.06%
All Indica	2759	92.60%	7.20%	0.07%	0.00%	T: 0.11%
All Japonica	1512	96.10%	3.90%	0.00%	0.00%	NA
Aus	269	18.60%	81.40%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.00%	T: 0.17%
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	91.10%	8.70%	0.00%	0.00%	T: 0.22%
Indica Intermediate	786	87.80%	12.00%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126648826	A -> T	LOC_Os01g46760.1	upstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0126648826	A -> T	LOC_Os01g46750-LOC_Os01g46760	intergenic_region ; MODIFIER	silent_mutation	Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0126648826	A -> C	LOC_Os01g46760.1	upstream_gene_variant ; 4118.0bp to feature; MODIFIER	silent_mutation	Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0126648826	A -> C	LOC_Os01g46750-LOC_Os01g46760	intergenic_region ; MODIFIER	silent_mutation	Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126648826	7.35E-06	7.35E-06	mr1249	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	3.34E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	4.72E-06	4.72E-06	mr1151_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	6.75E-07	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	9.19E-06	2.82E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	7.64E-06	mr1469_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	1.64E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	1.66E-10	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	2.13E-15	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	9.30E-06	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	1.09E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	1.47E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	5.51E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	6.45E-06	mr1922_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826	NA	4.85E-08	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251