\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126648826:

Variant ID: vg0126648826 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26648826
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGATGTGACGGAAAAGTTGAAAGTTTAAAGAAAAAACTAGCATGGTGGCCCGCGCAGATTGCGTGGTTAGCATCATTATATTTTATCTCATACAATAG[A/C,T]
ATATATGTTTTCTCATTATATTATTCAAATATATTAAAATGACAACATAATTATAAATTTTGCAATAACATTACAAAACTACTAATGTGTAATATTCATA

Reverse complement sequence

TATGAATATTACACATTAGTAGTTTTGTAATGTTATTGCAAAATTTATAATTATGTTGTCATTTTAATATATTTGAATAATATAATGAGAAAACATATAT[T/G,A]
CTATTGTATGAGATAAAATATAATGATGCTAACCACGCAATCTGCGCGGGCCACCATGCTAGTTTTTTCTTTAAACTTTCAACTTTTCCGTCACATCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 11.00% 0.06% 0.00% T: 0.06%
All Indica  2759 92.60% 7.20% 0.07% 0.00% T: 0.11%
All Japonica  1512 96.10% 3.90% 0.00% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.00% 0.00% T: 0.17%
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 91.10% 8.70% 0.00% 0.00% T: 0.22%
Indica Intermediate  786 87.80% 12.00% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126648826 A -> T LOC_Os01g46760.1 upstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0126648826 A -> T LOC_Os01g46750-LOC_Os01g46760 intergenic_region ; MODIFIER silent_mutation Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0126648826 A -> C LOC_Os01g46760.1 upstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0126648826 A -> C LOC_Os01g46750-LOC_Os01g46760 intergenic_region ; MODIFIER silent_mutation Average:29.907; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126648826 7.35E-06 7.35E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 3.34E-06 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 4.72E-06 4.72E-06 mr1151_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 6.75E-07 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 9.19E-06 2.82E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 7.64E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 1.64E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 1.66E-10 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 2.13E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 9.30E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 1.09E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 1.47E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 5.51E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 6.45E-06 mr1922_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126648826 NA 4.85E-08 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251