Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126579920:

Variant ID: vg0126579920 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26579920
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCCTGTTCTCTTTGTAACCTGTGTTTTCTACCATATAATCCCACATCAACTGGACTAGGGCTATTACCTATCAAGGTGCCTGAACCAGTATAATTCTT[G/C]
TCTTTTGTTTGCTTGATGTCGTACTACATAGATCCTTGTACCAACGTACCCCAATACCCTCTATATCCGGTCTACGGGTATCACCCGTCGACAGTATACA

Reverse complement sequence

TGTATACTGTCGACGGGTGATACCCGTAGACCGGATATAGAGGGTATTGGGGTACGTTGGTACAAGGATCTATGTAGTACGACATCAAGCAAACAAAAGA[C/G]
AAGAATTATACTGGTTCAGGCACCTTGATAGGTAATAGCCCTAGTCCAGTTGATGTGGGATTATATGGTAGAAAACACAGGTTACAAAGAGAACAGGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.20%	26.70%	0.08%	0.00%	NA
All Indica	2759	94.10%	5.80%	0.04%	0.00%	NA
All Japonica	1512	42.90%	56.90%	0.20%	0.00%	NA
Aus	269	24.50%	75.50%	0.00%	0.00%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	94.30%	5.70%	0.00%	0.00%	NA
Indica Intermediate	786	90.80%	9.00%	0.13%	0.00%	NA
Temperate Japonica	767	11.50%	88.50%	0.00%	0.00%	NA
Tropical Japonica	504	81.90%	17.70%	0.40%	0.00%	NA
Japonica Intermediate	241	61.00%	38.60%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126579920	G -> C	LOC_Os01g46670.1	upstream_gene_variant ; 1920.0bp to feature; MODIFIER	silent_mutation	Average:31.161; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg0126579920	G -> C	LOC_Os01g46690.1	upstream_gene_variant ; 3376.0bp to feature; MODIFIER	silent_mutation	Average:31.161; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg0126579920	G -> C	LOC_Os01g46680.1	downstream_gene_variant ; 1331.0bp to feature; MODIFIER	silent_mutation	Average:31.161; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg0126579920	G -> C	LOC_Os01g46670-LOC_Os01g46680	intergenic_region ; MODIFIER	silent_mutation	Average:31.161; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126579920	NA	4.48E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	5.62E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	2.41E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	1.76E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	1.89E-06	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	2.26E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	5.97E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	2.11E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	2.43E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	5.71E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	1.60E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	2.56E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	5.77E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	4.94E-06	4.94E-06	mr1779	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	1.40E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126579920	NA	6.27E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251