\
| Variant ID: vg0126542310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 26542310 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGACTCGGCTGGGACAGGCGTCGCCGGCCCCGCAGCAGCCGAATCCATCGCCCCACATGCACGATGGCCGGATCCGTGCCACCGCCGCCGAGATTCCTAG[T/G]
GGTTTGATTTTTTTTATTTTTATTTTTATGCGCGGACGACATAAGCACCCGCACGTGAAAAATCGGATTTTTGCAGACCATTTAGGGCAGAAGGGTTAGG
CCTAACCCTTCTGCCCTAAATGGTCTGCAAAAATCCGATTTTTCACGTGCGGGTGCTTATGTCGTCCGCGCATAAAAATAAAAATAAAAAAAATCAAACC[A/C]
CTAGGAATCTCGGCGGCGGTGGCACGGATCCGGCCATCGTGCATGTGGGGCGATGGATTCGGCTGCTGCGGGGCCGGCGACGCCTGTCCCAGCCGAGTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 3.70% | 0.02% | 0.76% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.00% | 0.07% | NA |
| All Japonica | 1512 | 97.80% | 0.00% | 0.00% | 2.25% | NA |
| Aus | 269 | 48.00% | 51.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 0.00% | 0.00% | 6.15% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0126542310 | T -> G | LOC_Os01g46620.1 | upstream_gene_variant ; 1537.0bp to feature; MODIFIER | silent_mutation | Average:73.264; most accessible tissue: Minghui63 young leaf, score: 83.166 | N | N | N | N |
| vg0126542310 | T -> G | LOC_Os01g46626.1 | downstream_gene_variant ; 3471.0bp to feature; MODIFIER | silent_mutation | Average:73.264; most accessible tissue: Minghui63 young leaf, score: 83.166 | N | N | N | N |
| vg0126542310 | T -> G | LOC_Os01g46620-LOC_Os01g46626 | intergenic_region ; MODIFIER | silent_mutation | Average:73.264; most accessible tissue: Minghui63 young leaf, score: 83.166 | N | N | N | N |
| vg0126542310 | T -> DEL | N | N | silent_mutation | Average:73.264; most accessible tissue: Minghui63 young leaf, score: 83.166 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0126542310 | NA | 4.45E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 2.39E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 1.93E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 2.90E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 4.50E-08 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 1.25E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 4.83E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 1.32E-10 | mr1369 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 3.90E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 3.92E-07 | mr1651 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 4.00E-08 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0126542310 | NA | 5.08E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |