Variant ID: vg0126439526 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 26439526 |
Reference Allele: T | Alternative Allele: C,A |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 218. )
AGCTTGAGCATCACCAGAGCCCATCAATTGAAAGACCGCTCAGAAGCTGCCTGCGCTGGTCGTGATGTACAGAAGGGTTAGATTCATATATTGAGTAAAT[T/C,A]
TCAGAAAACTATAACTTTAGTGATAAAATTATCAGTTTGCTGCAACATTAGCGATATATTTCAGTTTGCTGCAACATTAGCGACATATTTCAGTTTGCTA
TAGCAAACTGAAATATGTCGCTAATGTTGCAGCAAACTGAAATATATCGCTAATGTTGCAGCAAACTGATAATTTTATCACTAAAGTTATAGTTTTCTGA[A/G,T]
ATTTACTCAATATATGAATCTAACCCTTCTGTACATCACGACCAGCGCAGGCAGCTTCTGAGCGGTCTTTCAATTGATGGGCTCTGGTGATGCTCAAGCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.20% | 6.20% | 0.00% | 0.00% | A: 0.53% |
All Indica | 2759 | 96.30% | 3.30% | 0.00% | 0.00% | A: 0.47% |
All Japonica | 1512 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
Aus | 269 | 95.20% | 0.40% | 0.00% | 0.00% | A: 4.46% |
Indica I | 595 | 95.30% | 4.40% | 0.00% | 0.00% | A: 0.34% |
Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 95.70% | 3.60% | 0.00% | 0.00% | A: 0.66% |
Indica Intermediate | 786 | 96.40% | 2.90% | 0.00% | 0.00% | A: 0.64% |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0126439526 | T -> A | LOC_Os01g46470-LOC_Os01g46490 | intergenic_region ; MODIFIER | silent_mutation | Average:60.898; most accessible tissue: Callus, score: 94.087 | N | N | N | N |
vg0126439526 | T -> C | LOC_Os01g46470-LOC_Os01g46490 | intergenic_region ; MODIFIER | silent_mutation | Average:60.898; most accessible tissue: Callus, score: 94.087 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0126439526 | NA | 3.74E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 2.48E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | 2.99E-06 | 2.99E-06 | mr1208 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 1.08E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 2.77E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | 9.81E-06 | 3.07E-08 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 5.12E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 3.29E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0126439526 | NA | 1.43E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |