Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126195723:

Variant ID: vg0126195723 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 26195723
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCTTCGTCCCACTGAAGAATAAGGCACACACATATTTTAAAGATTCAACTTTTTAAATATTTGATCAGTAACTATTTTATTATAAATAAAATTTTATT[T/G]
GTTAAAAATAATATTACTAGATTGATATTTAAATTTACTTTCATATGATTATGATTTTATTCTTATAAACATAGTAAATTTTTTTGACAAAAAATATATA

Reverse complement sequence

TATATATTTTTTGTCAAAAAAATTTACTATGTTTATAAGAATAAAATCATAATCATATGAAAGTAAATTTAAATATCAATCTAGTAATATTATTTTTAAC[A/C]
AATAAAATTTTATTTATAATAAAATAGTTACTGATCAAATATTTAAAAAGTTGAATCTTTAAAATATGTGTGTGCCTTATTCTTCAGTGGGACGAAGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	15.60%	3.49%	0.87%	NA
All Indica	2759	95.10%	4.20%	0.14%	0.58%	NA
All Japonica	1512	48.10%	39.80%	10.52%	1.52%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.50%	5.40%	0.17%	0.00%	NA
Indica II	465	96.60%	1.10%	0.43%	1.94%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	5.60%	0.13%	0.89%	NA
Temperate Japonica	767	9.30%	68.60%	19.30%	2.87%	NA
Tropical Japonica	504	98.00%	1.80%	0.20%	0.00%	NA
Japonica Intermediate	241	67.60%	27.80%	4.15%	0.41%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	20.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0126195723	T -> G	LOC_Os01g46080.1	upstream_gene_variant ; 2337.0bp to feature; MODIFIER	silent_mutation	Average:38.514; most accessible tissue: Callus, score: 78.266	N	N	N	N
vg0126195723	T -> G	LOC_Os01g46080.2	upstream_gene_variant ; 2337.0bp to feature; MODIFIER	silent_mutation	Average:38.514; most accessible tissue: Callus, score: 78.266	N	N	N	N
vg0126195723	T -> G	LOC_Os01g46070.1	downstream_gene_variant ; 1206.0bp to feature; MODIFIER	silent_mutation	Average:38.514; most accessible tissue: Callus, score: 78.266	N	N	N	N
vg0126195723	T -> G	LOC_Os01g46070-LOC_Os01g46080	intergenic_region ; MODIFIER	silent_mutation	Average:38.514; most accessible tissue: Callus, score: 78.266	N	N	N	N
vg0126195723	T -> DEL	N	N	silent_mutation	Average:38.514; most accessible tissue: Callus, score: 78.266	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0126195723	NA	4.93E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	2.43E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	1.52E-32	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	3.53E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	6.03E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	5.74E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.08E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	6.36E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.66E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	9.87E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	8.28E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	5.44E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	2.09E-31	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.69E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	2.92E-06	NA	mr1839	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.58E-12	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	1.06E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	1.48E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	1.55E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.88E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	4.33E-22	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	1.35E-28	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723	NA	2.78E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251