\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126195723:

Variant ID: vg0126195723 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26195723
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTTCGTCCCACTGAAGAATAAGGCACACACATATTTTAAAGATTCAACTTTTTAAATATTTGATCAGTAACTATTTTATTATAAATAAAATTTTATT[T/G]
GTTAAAAATAATATTACTAGATTGATATTTAAATTTACTTTCATATGATTATGATTTTATTCTTATAAACATAGTAAATTTTTTTGACAAAAAATATATA

Reverse complement sequence

TATATATTTTTTGTCAAAAAAATTTACTATGTTTATAAGAATAAAATCATAATCATATGAAAGTAAATTTAAATATCAATCTAGTAATATTATTTTTAAC[A/C]
AATAAAATTTTATTTATAATAAAATAGTTACTGATCAAATATTTAAAAAGTTGAATCTTTAAAATATGTGTGTGCCTTATTCTTCAGTGGGACGAAGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 15.60% 3.49% 0.87% NA
All Indica  2759 95.10% 4.20% 0.14% 0.58% NA
All Japonica  1512 48.10% 39.80% 10.52% 1.52% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.50% 5.40% 0.17% 0.00% NA
Indica II  465 96.60% 1.10% 0.43% 1.94% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 5.60% 0.13% 0.89% NA
Temperate Japonica  767 9.30% 68.60% 19.30% 2.87% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 67.60% 27.80% 4.15% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 75.60% 20.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126195723 T -> G LOC_Os01g46080.1 upstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:38.514; most accessible tissue: Callus, score: 78.266 N N N N
vg0126195723 T -> G LOC_Os01g46080.2 upstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:38.514; most accessible tissue: Callus, score: 78.266 N N N N
vg0126195723 T -> G LOC_Os01g46070.1 downstream_gene_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:38.514; most accessible tissue: Callus, score: 78.266 N N N N
vg0126195723 T -> G LOC_Os01g46070-LOC_Os01g46080 intergenic_region ; MODIFIER silent_mutation Average:38.514; most accessible tissue: Callus, score: 78.266 N N N N
vg0126195723 T -> DEL N N silent_mutation Average:38.514; most accessible tissue: Callus, score: 78.266 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126195723 NA 4.93E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 2.43E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 1.52E-32 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 3.53E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 6.03E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 5.74E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.08E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 6.36E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.66E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 9.87E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 8.28E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 5.44E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 2.09E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.69E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 2.92E-06 NA mr1839 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.58E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 1.06E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 1.48E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 1.55E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.88E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 4.33E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 1.35E-28 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126195723 NA 2.78E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251