\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0126099360:

Variant ID: vg0126099360 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 26099360
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACTTACGGTCCGCCTGGAATCAAATATGGGCCTCGTACAGAAAAAAAAATATTTCTGTAGTAGTGCCAATAAGAAGCCTAATACGTAATAGGCAATG[G/A]
CTTTGCTTTTACTCATCTTTCTTCAGAACATATATAAGGTAACAAATTCGTTTAATCATATGGAAGACACGCCCGCATAGACGCCTACGATACTACGCAC

Reverse complement sequence

GTGCGTAGTATCGTAGGCGTCTATGCGGGCGTGTCTTCCATATGATTAAACGAATTTGTTACCTTATATATGTTCTGAAGAAAGATGAGTAAAAGCAAAG[C/T]
CATTGCCTATTACGTATTAGGCTTCTTATTGGCACTACTACAGAAATATTTTTTTTTCTGTACGAGGCCCATATTTGATTCCAGGCGGACCGTAAGTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 30.40% 6.92% 6.92% NA
All Indica  2759 84.70% 14.00% 0.72% 0.65% NA
All Japonica  1512 10.30% 62.70% 12.37% 14.68% NA
Aus  269 6.70% 23.00% 41.64% 28.62% NA
Indica I  595 59.00% 40.80% 0.17% 0.00% NA
Indica II  465 97.00% 1.70% 0.22% 1.08% NA
Indica III  913 93.80% 5.30% 0.55% 0.44% NA
Indica Intermediate  786 86.30% 10.90% 1.65% 1.15% NA
Temperate Japonica  767 1.00% 94.90% 3.39% 0.65% NA
Tropical Japonica  504 24.40% 21.20% 24.21% 30.16% NA
Japonica Intermediate  241 10.00% 46.90% 16.18% 26.97% NA
VI/Aromatic  96 84.40% 8.30% 4.17% 3.12% NA
Intermediate  90 47.80% 40.00% 4.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0126099360 G -> A LOC_Os01g45940.1 upstream_gene_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:62.328; most accessible tissue: Minghui63 root, score: 83.674 N N N N
vg0126099360 G -> A LOC_Os01g45940-LOC_Os01g45960 intergenic_region ; MODIFIER silent_mutation Average:62.328; most accessible tissue: Minghui63 root, score: 83.674 N N N N
vg0126099360 G -> DEL N N silent_mutation Average:62.328; most accessible tissue: Minghui63 root, score: 83.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0126099360 NA 2.16E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.40E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.34E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 7.35E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 3.59E-08 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 6.09E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.33E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.87E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 3.55E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 3.14E-09 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 7.54E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.58E-11 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.86E-10 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 6.46E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.12E-22 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.46E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 3.88E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.63E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 6.21E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.85E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 6.53E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.39E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 8.56E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.91E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 3.72E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 7.86E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 8.40E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 5.93E-10 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 1.58E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 2.71E-08 mr1923_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0126099360 NA 5.52E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251