Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125687545:

Variant ID: vg0125687545 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25687545
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGATATATATAAAATATTGTTATATTTATTAATAAAAATATACGATGACGTAGAAAGGTTGTCAGGATCGGGATACTAGGTAGTATCGTTTTGCTCAAA[G/A]
TAATATCGTATCGTAGGATCGGGATACTATGAGATTTTTTAAAAAAATTAATTACTATTTATATTAATTATATATAGACATTCTATATAAAAAAATATAG

Reverse complement sequence

CTATATTTTTTTATATAGAATGTCTATATATAATTAATATAAATAGTAATTAATTTTTTTAAAAAATCTCATAGTATCCCGATCCTACGATACGATATTA[C/T]
TTTGAGCAAAACGATACTACCTAGTATCCCGATCCTGACAACCTTTCTACGTCATCGTATATTTTTATTAATAAATATAACAATATTTTATATATATCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	18.10%	0.17%	0.02%	NA
All Indica	2759	97.20%	2.80%	0.07%	0.00%	NA
All Japonica	1512	69.80%	30.00%	0.20%	0.07%	NA
Aus	269	5.90%	93.70%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	96.90%	3.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.50%	0.25%	0.00%	NA
Temperate Japonica	767	96.90%	2.70%	0.26%	0.13%	NA
Tropical Japonica	504	29.80%	70.20%	0.00%	0.00%	NA
Japonica Intermediate	241	67.20%	32.40%	0.41%	0.00%	NA
VI/Aromatic	96	38.50%	60.40%	1.04%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125687545	G -> A	LOC_Os01g45260.1	upstream_gene_variant ; 2794.0bp to feature; MODIFIER	silent_mutation	Average:23.996; most accessible tissue: Callus, score: 56.322	N	N	N	N
vg0125687545	G -> A	LOC_Os01g45250.1	downstream_gene_variant ; 4469.0bp to feature; MODIFIER	silent_mutation	Average:23.996; most accessible tissue: Callus, score: 56.322	N	N	N	N
vg0125687545	G -> A	LOC_Os01g45250-LOC_Os01g45260	intergenic_region ; MODIFIER	silent_mutation	Average:23.996; most accessible tissue: Callus, score: 56.322	N	N	N	N
vg0125687545	G -> DEL	N	N	silent_mutation	Average:23.996; most accessible tissue: Callus, score: 56.322	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125687545	NA	1.26E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	8.94E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	9.82E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	7.23E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	4.14E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	1.40E-17	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	4.54E-09	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	5.38E-13	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	3.46E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	1.85E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	8.72E-10	mr1916	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.32E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	6.41E-15	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.08E-15	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	4.89E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.24E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	5.26E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	6.55E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	6.36E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	9.53E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.46E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	1.87E-16	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	5.75E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.27E-12	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	1.36E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	8.59E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125687545	NA	2.18E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251