Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125636241:

Variant ID: vg0125636241 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25636241
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, A: 0.41, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATATGCCAATGCAACGGTAAAGTATTGATTCCAAACTAGCAGATCTACGTAGTTACTGATATCTACAATACGCACTTCTAGATTAGTACAACTAAAA[A/C]
CCTAAAAAAATAATGCATTTATTCAAACAAAGTTTTAAAAAAATACACACTATTTAACTCAATAGTCACATATAGGATCTATGAATATTACCTGAAATCG

Reverse complement sequence

CGATTTCAGGTAATATTCATAGATCCTATATGTGACTATTGAGTTAAATAGTGTGTATTTTTTTAAAACTTTGTTTGAATAAATGCATTATTTTTTTAGG[T/G]
TTTTAGTTGTACTAATCTAGAAGTGCGTATTGTAGATATCAGTAACTACGTAGATCTGCTAGTTTGGAATCAATACTTTACCGTTGCATTGGCATATACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	0.10%	11.15%	60.79%	NA
All Indica	2759	14.80%	0.10%	7.72%	77.46%	NA
All Japonica	1512	55.80%	0.10%	11.77%	32.28%	NA
Aus	269	2.60%	0.40%	41.64%	55.39%	NA
Indica I	595	5.20%	0.00%	14.96%	79.83%	NA
Indica II	465	7.50%	0.20%	1.08%	91.18%	NA
Indica III	913	27.10%	0.10%	5.15%	67.69%	NA
Indica Intermediate	786	12.00%	0.00%	9.16%	78.88%	NA
Temperate Japonica	767	88.30%	0.00%	6.26%	5.48%	NA
Tropical Japonica	504	16.30%	0.40%	13.29%	70.04%	NA
Japonica Intermediate	241	35.30%	0.00%	26.14%	38.59%	NA
VI/Aromatic	96	32.30%	0.00%	18.75%	48.96%	NA
Intermediate	90	35.60%	0.00%	6.67%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125636241	A -> DEL	N	N	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N
vg0125636241	A -> C	LOC_Os01g45174.1	upstream_gene_variant ; 170.0bp to feature; MODIFIER	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N
vg0125636241	A -> C	LOC_Os01g45190.1	upstream_gene_variant ; 709.0bp to feature; MODIFIER	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N
vg0125636241	A -> C	LOC_Os01g45190.3	upstream_gene_variant ; 717.0bp to feature; MODIFIER	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N
vg0125636241	A -> C	LOC_Os01g45200.1	downstream_gene_variant ; 4478.0bp to feature; MODIFIER	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N
vg0125636241	A -> C	LOC_Os01g45174-LOC_Os01g45190	intergenic_region ; MODIFIER	silent_mutation	Average:32.47; most accessible tissue: Minghui63 flower, score: 46.748	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125636241	NA	5.15E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	5.24E-07	5.24E-07	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	1.61E-09	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	1.58E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	6.86E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	1.68E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	3.60E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	4.97E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	1.21E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	7.53E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	6.64E-10	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	5.09E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	5.66E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	4.62E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	2.52E-11	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	1.07E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125636241	NA	3.16E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251