\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125115772:

Variant ID: vg0125115772 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25115772
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAATATAAGTGATTTTGAACGGATGTGACACTTTTTAGTCCAACAAATCTTTTTCTGTTTAGATTTGTTGCAGTAGTAAGTCATATCCACCTAAAATC[C/T]
CTTATATTTTGAGGCAGGGGAATATATATTACTTCTCTCAAATCAGTCCAACGACATTTCCAATACGGAGAAGTCCTACCACATGGTATGTAAAGGTATA

Reverse complement sequence

TATACCTTTACATACCATGTGGTAGGACTTCTCCGTATTGGAAATGTCGTTGGACTGATTTGAGAGAAGTAATATATATTCCCCTGCCTCAAAATATAAG[G/A]
GATTTTAGGTGGATATGACTTACTACTGCAACAAATCTAAACAGAAAAAGATTTGTTGGACTAAAAAGTGTCACATCCGTTCAAAATCACTTATATTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 0.30% 0.17% 24.04% NA
All Indica  2759 58.70% 0.50% 0.25% 40.52% NA
All Japonica  1512 99.50% 0.00% 0.00% 0.46% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.20% 0.00% 0.17% 32.61% NA
Indica II  465 50.30% 0.60% 0.22% 48.82% NA
Indica III  913 57.50% 0.90% 0.11% 41.51% NA
Indica Intermediate  786 58.50% 0.50% 0.51% 40.46% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 87.80% 1.10% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125115772 C -> T LOC_Os01g43830.1 upstream_gene_variant ; 3724.0bp to feature; MODIFIER silent_mutation Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572 N N N N
vg0125115772 C -> T LOC_Os01g43851.1 upstream_gene_variant ; 3962.0bp to feature; MODIFIER silent_mutation Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572 N N N N
vg0125115772 C -> T LOC_Os01g43844.1 intron_variant ; MODIFIER silent_mutation Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572 N N N N
vg0125115772 C -> DEL N N silent_mutation Average:79.788; most accessible tissue: Zhenshan97 young leaf, score: 97.572 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0125115772 C T -0.01 0.0 -0.02 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125115772 NA 6.06E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 7.18E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 7.10E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 7.07E-06 7.07E-06 mr1420 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 2.86E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 3.88E-06 3.88E-06 mr1748 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 1.13E-06 mr1763 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 2.97E-06 2.72E-08 mr1811 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 1.87E-06 1.87E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 1.47E-06 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 2.52E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125115772 NA 3.35E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251