\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125037562:

Variant ID: vg0125037562 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 25037562
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTATGTAACCAAAATTACTTTCTTAATAGTCTGCAATATACTTTTAAAGCTATTTACTTCAAATATAATAGTTAAAAATACATTTGTTATATAGGAG[C/T]
TCACCCCTTTTAATTTTCCTGCCGACTTTTTATCTTAAACTTAAAAAATGCTGGTTTTAGTCCAAACAAACAAATATTTGCAAACAAATGGAGTATTTGT

Reverse complement sequence

ACAAATACTCCATTTGTTTGCAAATATTTGTTTGTTTGGACTAAAACCAGCATTTTTTAAGTTTAAGATAAAAAGTCGGCAGGAAAATTAAAAGGGGTGA[G/A]
CTCCTATATAACAAATGTATTTTTAACTATTATATTTGAAGTAAATAGCTTTAAAAGTATATTGCAGACTATTAAGAAAGTAATTTTGGTTACATAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 20.40% 0.02% 0.23% NA
All Indica  2759 76.90% 22.70% 0.04% 0.36% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 5.90% 93.70% 0.00% 0.37% NA
Indica I  595 71.30% 28.40% 0.00% 0.34% NA
Indica II  465 96.80% 3.00% 0.00% 0.22% NA
Indica III  913 63.30% 36.10% 0.00% 0.55% NA
Indica Intermediate  786 85.20% 14.40% 0.13% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0125037562 C -> T LOC_Os01g43680.1 upstream_gene_variant ; 4316.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43700.1 upstream_gene_variant ; 3139.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43680.2 upstream_gene_variant ; 4316.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43680.3 upstream_gene_variant ; 4316.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43700.2 upstream_gene_variant ; 2652.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43690.1 downstream_gene_variant ; 904.0bp to feature; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> T LOC_Os01g43680-LOC_Os01g43690 intergenic_region ; MODIFIER silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N
vg0125037562 C -> DEL N N silent_mutation Average:61.146; most accessible tissue: Minghui63 root, score: 90.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0125037562 NA 1.16E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0125037562 NA 4.45E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 1.05E-10 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 2.70E-09 mr1740 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 4.00E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 3.17E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 2.66E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 1.44E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 4.43E-07 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 3.59E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 2.31E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 5.92E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 3.02E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 6.43E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 5.73E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 4.59E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562 NA 5.30E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251