Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0125037562:

Variant ID: vg0125037562 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 25037562
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATTATGTAACCAAAATTACTTTCTTAATAGTCTGCAATATACTTTTAAAGCTATTTACTTCAAATATAATAGTTAAAAATACATTTGTTATATAGGAG[C/T]
TCACCCCTTTTAATTTTCCTGCCGACTTTTTATCTTAAACTTAAAAAATGCTGGTTTTAGTCCAAACAAACAAATATTTGCAAACAAATGGAGTATTTGT

Reverse complement sequence

ACAAATACTCCATTTGTTTGCAAATATTTGTTTGTTTGGACTAAAACCAGCATTTTTTAAGTTTAAGATAAAAAGTCGGCAGGAAAATTAAAAGGGGTGA[G/A]
CTCCTATATAACAAATGTATTTTTAACTATTATATTTGAAGTAAATAGCTTTAAAAGTATATTGCAGACTATTAAGAAAGTAATTTTGGTTACATAATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	20.40%	0.02%	0.23%	NA
All Indica	2759	76.90%	22.70%	0.04%	0.36%	NA
All Japonica	1512	96.40%	3.60%	0.00%	0.00%	NA
Aus	269	5.90%	93.70%	0.00%	0.37%	NA
Indica I	595	71.30%	28.40%	0.00%	0.34%	NA
Indica II	465	96.80%	3.00%	0.00%	0.22%	NA
Indica III	913	63.30%	36.10%	0.00%	0.55%	NA
Indica Intermediate	786	85.20%	14.40%	0.13%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	90.50%	9.50%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0125037562	C -> T	LOC_Os01g43680.1	upstream_gene_variant ; 4316.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43700.1	upstream_gene_variant ; 3139.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43680.2	upstream_gene_variant ; 4316.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43680.3	upstream_gene_variant ; 4316.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43700.2	upstream_gene_variant ; 2652.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43690.1	downstream_gene_variant ; 904.0bp to feature; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> T	LOC_Os01g43680-LOC_Os01g43690	intergenic_region ; MODIFIER	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N
vg0125037562	C -> DEL	N	N	silent_mutation	Average:61.146; most accessible tissue: Minghui63 root, score: 90.598	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0125037562	NA	1.16E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0125037562	NA	4.45E-08	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	1.05E-10	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	2.70E-09	mr1740	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	4.00E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	3.17E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	2.66E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	1.44E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	4.43E-07	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	3.59E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	2.31E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	5.92E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	3.02E-07	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	6.43E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	5.73E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	4.59E-11	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0125037562	NA	5.30E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251