\
| Variant ID: vg0124680654 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24680654 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )
GCATATATTTAGGGGGAGCAAATCCTATACATTTATTGTGCATGTTCTAGATCCATGTTGTTCACCTATTATTTATATCGGATCTTTGCACTTGAGCTTG[T/C]
ATACGAGTATATGACACTTGTGATGTTAATGAATACTCAACAAACATATCCATATCTTTCATATGCAACCAGTTGGTCATCAAGTGAAGGATGATAACCG
CGGTTATCATCCTTCACTTGATGACCAACTGGTTGCATATGAAAGATATGGATATGTTTGTTGAGTATTCATTAACATCACAAGTGTCATATACTCGTAT[A/G]
CAAGCTCAAGTGCAAAGATCCGATATAAATAATAGGTGAACAACATGGATCTAGAACATGCACAATAAATGTATAGGATTTGCTCCCCCTAAATATATGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.80% | 0.30% | 19.28% | 58.61% | NA |
| All Indica | 2759 | 0.80% | 0.00% | 14.17% | 84.99% | NA |
| All Japonica | 1512 | 61.00% | 0.90% | 20.44% | 17.72% | NA |
| Aus | 269 | 1.10% | 0.00% | 61.71% | 37.17% | NA |
| Indica I | 595 | 1.30% | 0.00% | 1.85% | 96.81% | NA |
| Indica II | 465 | 0.20% | 0.00% | 5.59% | 94.19% | NA |
| Indica III | 913 | 0.10% | 0.00% | 27.71% | 72.18% | NA |
| Indica Intermediate | 786 | 1.70% | 0.00% | 12.85% | 85.50% | NA |
| Temperate Japonica | 767 | 80.70% | 0.80% | 14.47% | 4.04% | NA |
| Tropical Japonica | 504 | 25.80% | 1.40% | 33.53% | 39.29% | NA |
| Japonica Intermediate | 241 | 71.80% | 0.00% | 12.03% | 16.18% | NA |
| VI/Aromatic | 96 | 60.40% | 0.00% | 25.00% | 14.58% | NA |
| Intermediate | 90 | 28.90% | 0.00% | 23.33% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124680654 | T -> DEL | N | N | silent_mutation | Average:6.193; most accessible tissue: Callus, score: 15.203 | N | N | N | N |
| vg0124680654 | T -> C | LOC_Os01g43210.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.193; most accessible tissue: Callus, score: 15.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124680654 | NA | 7.92E-07 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 7.82E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 4.43E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | 8.41E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 9.16E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 6.17E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 6.99E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | 3.34E-07 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | 5.77E-07 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | NA | 1.95E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | 5.37E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124680654 | 8.73E-07 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |