Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124627216:

Variant ID: vg0124627216 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24627216
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCAAGTGGATAAAAATGTACATGCCAACTTGTCACAGAGATCTTGGGGTGCTTGATTTAGGGTATGTTTAGGTCCTTAGTAAAATTTTTCACCATGTCA[T/C]
ATTGAATGTTTGGACACATATATGGAGTATTGAATATAAATGAAAAAAATAATTAATTACACAGATTGCGTGTAAATTGCGAGACGAATCTTTTAAGCTT

Reverse complement sequence

AAGCTTAAAAGATTCGTCTCGCAATTTACACGCAATCTGTGTAATTAATTATTTTTTTCATTTATATTCAATACTCCATATATGTGTCCAAACATTCAAT[A/G]
TGACATGGTGAAAAATTTTACTAAGGACCTAAACATACCCTAAATCAAGCACCCCAAGATCTCTGTGACAAGTTGGCATGTACATTTTTATCCACTTGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	24.10%	0.04%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	30.30%	69.60%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	4.20%	95.80%	0.00%	0.00%	NA
Tropical Japonica	504	72.00%	27.80%	0.20%	0.00%	NA
Japonica Intermediate	241	26.10%	73.40%	0.41%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124627216	T -> C	LOC_Os01g43150.1	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0124627216	T -> C	LOC_Os01g43160.1	upstream_gene_variant ; 2054.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0124627216	T -> C	LOC_Os01g43150.3	upstream_gene_variant ; 4469.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg0124627216	T -> C	LOC_Os01g43150-LOC_Os01g43160	intergenic_region ; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124627216	2.76E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	3.00E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.35E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.40E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.20E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	3.83E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	3.60E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	1.78E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	6.60E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	6.62E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	7.22E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	7.51E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	5.09E-09	4.27E-96	mr1334_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.17E-18	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	1.66E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.79E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	8.89E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	9.30E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	9.44E-41	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	1.85E-43	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	4.75E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	1.81E-28	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	7.58E-09	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124627216	NA	2.43E-08	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251