\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124556493:

Variant ID: vg0124556493 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24556493
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGTTTGAAAAGCGTGCCACGAGTATCCAAAAGTTTATCCAACTTTTGTTGGAGAAAAGAACAGGGCTTATCAATCTTTCGCTTTACTAATAAATAATA[T/C]
TCCCTCCATCTATTTTTGATAGTCATATTTCCAAATCTGAAAATTTTATTTTTGATAGGCATATTTCAATCCAACAACTTATCATATTGATGACTTTCTT

Reverse complement sequence

AAGAAAGTCATCAATATGATAAGTTGTTGGATTGAAATATGCCTATCAAAAATAAAATTTTCAGATTTGGAAATATGACTATCAAAAATAGATGGAGGGA[A/G]
TATTATTTATTAGTAAAGCGAAAGATTGATAAGCCCTGTTCTTTTCTCCAACAAAAGTTGGATAAACTTTTGGATACTCGTGGCACGCTTTTCAAACCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 28.50% 1.80% 20.42% NA
All Indica  2759 73.10% 2.90% 2.28% 21.78% NA
All Japonica  1512 14.50% 77.10% 0.40% 8.00% NA
Aus  269 17.10% 1.50% 2.60% 78.81% NA
Indica I  595 99.00% 0.30% 0.34% 0.34% NA
Indica II  465 65.80% 1.30% 1.51% 31.40% NA
Indica III  913 60.00% 4.10% 4.38% 31.54% NA
Indica Intermediate  786 72.90% 4.30% 1.78% 20.99% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 36.10% 43.30% 0.20% 20.44% NA
Japonica Intermediate  241 9.50% 81.30% 1.66% 7.47% NA
VI/Aromatic  96 9.40% 70.80% 3.12% 16.67% NA
Intermediate  90 41.10% 35.60% 6.67% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124556493 T -> DEL N N silent_mutation Average:24.111; most accessible tissue: Callus, score: 56.432 N N N N
vg0124556493 T -> C LOC_Os01g43040.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:24.111; most accessible tissue: Callus, score: 56.432 N N N N
vg0124556493 T -> C LOC_Os01g43050.1 upstream_gene_variant ; 2836.0bp to feature; MODIFIER silent_mutation Average:24.111; most accessible tissue: Callus, score: 56.432 N N N N
vg0124556493 T -> C LOC_Os01g43040-LOC_Os01g43050 intergenic_region ; MODIFIER silent_mutation Average:24.111; most accessible tissue: Callus, score: 56.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124556493 NA 7.25E-07 mr1227 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 1.92E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 2.81E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 7.47E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 5.03E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 1.23E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 8.77E-10 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 4.50E-07 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 1.46E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 5.78E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 3.71E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 7.62E-10 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 1.51E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124556493 NA 3.52E-13 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251