\
| Variant ID: vg0124416834 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 24416834 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGACGGCAGGGCCATGGGCGGCGGTGGCAGGCCAATACCTGGTTGCGCATGGTAGCAGAGGTGGTCAGGAGAACAGCGCCGCGGCAGGTAGCAGCGAGC[T/C]
GTCGACGACGCCATGGCGGTGTTTCTTTGGGAGGCGGTGGGCGCTGCGGAGGACGTTGGCGGCAGGTGCGACGGAGGATGGTGGCGGCGGATGCGGCGGA
TCCGCCGCATCCGCCGCCACCATCCTCCGTCGCACCTGCCGCCAACGTCCTCCGCAGCGCCCACCGCCTCCCAAAGAAACACCGCCATGGCGTCGTCGAC[A/G]
GCTCGCTGCTACCTGCCGCGGCGCTGTTCTCCTGACCACCTCTGCTACCATGCGCAACCAGGTATTGGCCTGCCACCGCCGCCCATGGCCCTGCCGTCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.30% | 21.40% | 0.15% | 0.11% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 40.20% | 59.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.00% | 0.60% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 19.00% | 80.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 34.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 54.80% | 44.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0124416834 | T -> DEL | LOC_Os01g42909.1 | N | frameshift_variant | Average:75.328; most accessible tissue: Minghui63 young leaf, score: 85.633 | N | N | N | N |
| vg0124416834 | T -> C | LOC_Os01g42909.1 | synonymous_variant ; p.Thr5Thr; LOW | synonymous_codon | Average:75.328; most accessible tissue: Minghui63 young leaf, score: 85.633 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0124416834 | NA | 3.78E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | 5.94E-07 | NA | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 3.59E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 5.56E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 2.25E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 1.36E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 5.85E-10 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 1.35E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 3.22E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 2.17E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | 3.77E-06 | NA | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0124416834 | NA | 2.81E-07 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |