\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124363805:

Variant ID: vg0124363805 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24363805
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACGTTCTTCATGATTACAGTTGGTGAAACTGTACTGCTTGCCACTAAGCATCAGCGGCAGTATAATTGCTACTCACATGAGTTTGGTTGAAATTGAAA[C/T]
GATATGACGGAAAAGTTAAAAGTTTGTATGTGTAGAAAAGTTTTGATGTGATAGAAAAATTAGAAGTTTGAAGAAAAATTTAGAACTAAACACGGCGTAC

Reverse complement sequence

GTACGCCGTGTTTAGTTCTAAATTTTTCTTCAAACTTCTAATTTTTCTATCACATCAAAACTTTTCTACACATACAAACTTTTAACTTTTCCGTCATATC[G/A]
TTTCAATTTCAACCAAACTCATGTGAGTAGCAATTATACTGCCGCTGATGCTTAGTGGCAAGCAGTACAGTTTCACCAACTGTAATCATGAAGAACGTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.30% 0.00% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 82.20% 17.80% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.70% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 52.40% 47.60% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124363805 C -> T LOC_Os01g42800.1 upstream_gene_variant ; 3321.0bp to feature; MODIFIER silent_mutation Average:74.176; most accessible tissue: Callus, score: 90.5 N N N N
vg0124363805 C -> T LOC_Os01g42810.1 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:74.176; most accessible tissue: Callus, score: 90.5 N N N N
vg0124363805 C -> T LOC_Os01g42820.2 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:74.176; most accessible tissue: Callus, score: 90.5 N N N N
vg0124363805 C -> T LOC_Os01g42820.3 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:74.176; most accessible tissue: Callus, score: 90.5 N N N N
vg0124363805 C -> T LOC_Os01g42800-LOC_Os01g42810 intergenic_region ; MODIFIER silent_mutation Average:74.176; most accessible tissue: Callus, score: 90.5 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0124363805 C T 0.02 0.01 0.0 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124363805 NA 1.58E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 5.10E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 7.81E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 9.40E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 9.02E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 4.09E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 1.80E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 2.51E-08 mr1479_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 1.50E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 3.12E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124363805 NA 2.09E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251