\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124307645:

Variant ID: vg0124307645 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24307645
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCCTTAGGTCCTCCCGGGGGTCCCTTTTATATCGCAGGCCAACTGGTCTCCAAGTAGGACACGGAGGCATCGGACCCGGCACGATACAATGACGACCC[A/G]
GTTCCGTCCGAGTAGGACTCCTTTCATCTGTGAACTCCATGATAAATTTCCTTAACGTATGCAAAAAACGTCCGTATACGTGCAAAGGTACCATATCGAT

Reverse complement sequence

ATCGATATGGTACCTTTGCACGTATACGGACGTTTTTTGCATACGTTAAGGAAATTTATCATGGAGTTCACAGATGAAAGGAGTCCTACTCGGACGGAAC[T/C]
GGGTCGTCATTGTATCGTGCCGGGTCCGATGCCTCCGTGTCCTACTTGGAGACCAGTTGGCCTGCGATATAAAAGGGACCCCCGGGAGGACCTAAGGCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 44.30% 0.06% 0.02% NA
All Indica  2759 92.60% 7.30% 0.04% 0.04% NA
All Japonica  1512 2.10% 97.80% 0.07% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 87.30% 12.60% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 94.80% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124307645 A -> G LOC_Os01g42730.1 upstream_gene_variant ; 4956.0bp to feature; MODIFIER silent_mutation Average:68.231; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0124307645 A -> G LOC_Os01g42720-LOC_Os01g42730 intergenic_region ; MODIFIER silent_mutation Average:68.231; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N
vg0124307645 A -> DEL N N silent_mutation Average:68.231; most accessible tissue: Zhenshan97 root, score: 80.909 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124307645 NA 9.14E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 2.34E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 3.10E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.37E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 2.55E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.61E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.91E-24 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.07E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.32E-15 mr1325_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.45E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 2.87E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 5.41E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 3.34E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 2.65E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 3.19E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.90E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 1.08E-10 mr1690_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 2.64E-18 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124307645 NA 3.09E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251