Variant ID: vg0124253318 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 24253318 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACACAGGATTTTAATAGGAATATAAGTGCAAAACAGAAAGATTACAAAACACAGAAACACACAAAGAATGACCGTTTGATTGGACCACATGAAAAACATA[G/T]
GAATCGGATGAAAGAGATAAACTAAAAGAAAATTTTCCAAGATATTGAAGTTATTGCTAAATTTTCTTTAAAATCTCTTTGGGATTGTTTATTCCATAGG
CCTATGGAATAAACAATCCCAAAGAGATTTTAAAGAAAATTTAGCAATAACTTCAATATCTTGGAAAATTTTCTTTTAGTTTATCTCTTTCATCCGATTC[C/A]
TATGTTTTTCATGTGGTCCAATCAAACGGTCATTCTTTGTGTGTTTCTGTGTTTTGTAATCTTTCTGTTTTGCACTTATATTCCTATTAAAATCCTGTGT
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 55.10% | 44.70% | 0.15% | 0.00% | NA |
All Indica | 2759 | 86.60% | 13.20% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 11.20% | 88.80% | 0.00% | 0.00% | NA |
Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 88.20% | 11.60% | 0.17% | 0.00% | NA |
Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
Indica III | 913 | 83.70% | 16.20% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 82.60% | 17.20% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 29.80% | 70.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 45.60% | 52.20% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0124253318 | G -> T | LOC_Os01g42630.1 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
vg0124253318 | G -> T | LOC_Os01g42650.1 | upstream_gene_variant ; 1981.0bp to feature; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
vg0124253318 | G -> T | LOC_Os01g42630.2 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
vg0124253318 | G -> T | LOC_Os01g42630.3 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
vg0124253318 | G -> T | LOC_Os01g42640.1 | downstream_gene_variant ; 2581.0bp to feature; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
vg0124253318 | G -> T | LOC_Os01g42640-LOC_Os01g42650 | intergenic_region ; MODIFIER | silent_mutation | Average:36.151; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0124253318 | NA | 7.37E-21 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 2.60E-18 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 5.42E-15 | mr1883 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 4.97E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 2.16E-49 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 1.37E-34 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 1.77E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 3.30E-27 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 7.52E-16 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 2.73E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 4.82E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 1.83E-14 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0124253318 | NA | 2.33E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |