\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124253318:

Variant ID: vg0124253318 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 24253318
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACAGGATTTTAATAGGAATATAAGTGCAAAACAGAAAGATTACAAAACACAGAAACACACAAAGAATGACCGTTTGATTGGACCACATGAAAAACATA[G/T]
GAATCGGATGAAAGAGATAAACTAAAAGAAAATTTTCCAAGATATTGAAGTTATTGCTAAATTTTCTTTAAAATCTCTTTGGGATTGTTTATTCCATAGG

Reverse complement sequence

CCTATGGAATAAACAATCCCAAAGAGATTTTAAAGAAAATTTAGCAATAACTTCAATATCTTGGAAAATTTTCTTTTAGTTTATCTCTTTCATCCGATTC[C/A]
TATGTTTTTCATGTGGTCCAATCAAACGGTCATTCTTTGTGTGTTTCTGTGTTTTGTAATCTTTCTGTTTTGCACTTATATTCCTATTAAAATCCTGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 44.70% 0.15% 0.00% NA
All Indica  2759 86.60% 13.20% 0.18% 0.00% NA
All Japonica  1512 11.20% 88.80% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 88.20% 11.60% 0.17% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 83.70% 16.20% 0.11% 0.00% NA
Indica Intermediate  786 82.60% 17.20% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 29.80% 70.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.20% 93.80% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0124253318 G -> T LOC_Os01g42630.1 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N
vg0124253318 G -> T LOC_Os01g42650.1 upstream_gene_variant ; 1981.0bp to feature; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N
vg0124253318 G -> T LOC_Os01g42630.2 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N
vg0124253318 G -> T LOC_Os01g42630.3 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N
vg0124253318 G -> T LOC_Os01g42640.1 downstream_gene_variant ; 2581.0bp to feature; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N
vg0124253318 G -> T LOC_Os01g42640-LOC_Os01g42650 intergenic_region ; MODIFIER silent_mutation Average:36.151; most accessible tissue: Callus, score: 70.622 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0124253318 NA 7.37E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 2.60E-18 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 5.42E-15 mr1883 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 4.97E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 2.16E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 1.37E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 1.77E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 3.30E-27 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 7.52E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 2.73E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 4.82E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 1.83E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124253318 NA 2.33E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251