\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123927172:

Variant ID: vg0123927172 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 23927172
Reference Allele: GAlternative Allele: A,GTAGAA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTACTGACCGAGCTATGTTAGGCGGTGTTTGGTTGGAGGGATTAAAGTGGTGCTAAACTTTAGTCCCTCTCACAAAAATATAAGTTCTTACCATAGG[G/A,GTAGAA]
ACTTATACTTTTGTGAGAGGGACTAAATTTAGTCCCTAGTTCCCAAACACCCCCTTAAAATGGTTACAGACAAAAAAAAATAAAATAAAAAAAGAAACAT

Reverse complement sequence

ATGTTTCTTTTTTTATTTTATTTTTTTTTGTCTGTAACCATTTTAAGGGGGTGTTTGGGAACTAGGGACTAAATTTAGTCCCTCTCACAAAAGTATAAGT[C/T,TTCTAC]
CCTATGGTAAGAACTTATATTTTTGTGAGAGGGACTAAAGTTTAGCACCACTTTAATCCCTCCAACCAAACACCGCCTAACATAGCTCGGTCAGTAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 27.70% 1.16% 0.00% GTAGAA: 2.98%
All Indica  2759 69.80% 29.50% 0.40% 0.00% GTAGAA: 0.25%
All Japonica  1512 77.40% 11.80% 2.25% 0.00% GTAGAA: 8.60%
Aus  269 2.60% 94.10% 3.35% 0.00% NA
Indica I  595 40.70% 58.80% 0.50% 0.00% NA
Indica II  465 88.40% 11.00% 0.00% 0.00% GTAGAA: 0.65%
Indica III  913 76.00% 23.90% 0.11% 0.00% NA
Indica Intermediate  786 73.80% 24.80% 0.89% 0.00% GTAGAA: 0.51%
Temperate Japonica  767 98.80% 0.80% 0.00% 0.00% GTAGAA: 0.39%
Tropical Japonica  504 49.00% 21.80% 6.15% 0.00% GTAGAA: 23.02%
Japonica Intermediate  241 68.50% 25.70% 1.24% 0.00% GTAGAA: 4.56%
VI/Aromatic  96 54.20% 44.80% 1.04% 0.00% NA
Intermediate  90 73.30% 22.20% 0.00% 0.00% GTAGAA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123927172 G -> A LOC_Os01g42234.2 upstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0123927172 G -> A LOC_Os01g42220.1 downstream_gene_variant ; 4310.0bp to feature; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0123927172 G -> A LOC_Os01g42234.1 intron_variant ; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0123927172 G -> GTAGAA LOC_Os01g42234.2 upstream_gene_variant ; 2518.0bp to feature; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0123927172 G -> GTAGAA LOC_Os01g42220.1 downstream_gene_variant ; 4311.0bp to feature; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0123927172 G -> GTAGAA LOC_Os01g42234.1 intron_variant ; MODIFIER silent_mutation Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123927172 NA 4.72E-06 mr1127_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 4.42E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 3.08E-07 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 1.93E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 6.72E-06 mr1545_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 2.86E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 2.38E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172 NA 1.45E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251