Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0123927172:

Variant ID: vg0123927172 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 23927172
Reference Allele: G	Alternative Allele: A,GTAGAA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTACTGACCGAGCTATGTTAGGCGGTGTTTGGTTGGAGGGATTAAAGTGGTGCTAAACTTTAGTCCCTCTCACAAAAATATAAGTTCTTACCATAGG[G/A,GTAGAA]
ACTTATACTTTTGTGAGAGGGACTAAATTTAGTCCCTAGTTCCCAAACACCCCCTTAAAATGGTTACAGACAAAAAAAAATAAAATAAAAAAAGAAACAT

Reverse complement sequence

ATGTTTCTTTTTTTATTTTATTTTTTTTTGTCTGTAACCATTTTAAGGGGGTGTTTGGGAACTAGGGACTAAATTTAGTCCCTCTCACAAAAGTATAAGT[C/T,TTCTAC]
CCTATGGTAAGAACTTATATTTTTGTGAGAGGGACTAAAGTTTAGCACCACTTTAATCCCTCCAACCAAACACCGCCTAACATAGCTCGGTCAGTAACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	27.70%	1.16%	0.00%	GTAGAA: 2.98%
All Indica	2759	69.80%	29.50%	0.40%	0.00%	GTAGAA: 0.25%
All Japonica	1512	77.40%	11.80%	2.25%	0.00%	GTAGAA: 8.60%
Aus	269	2.60%	94.10%	3.35%	0.00%	NA
Indica I	595	40.70%	58.80%	0.50%	0.00%	NA
Indica II	465	88.40%	11.00%	0.00%	0.00%	GTAGAA: 0.65%
Indica III	913	76.00%	23.90%	0.11%	0.00%	NA
Indica Intermediate	786	73.80%	24.80%	0.89%	0.00%	GTAGAA: 0.51%
Temperate Japonica	767	98.80%	0.80%	0.00%	0.00%	GTAGAA: 0.39%
Tropical Japonica	504	49.00%	21.80%	6.15%	0.00%	GTAGAA: 23.02%
Japonica Intermediate	241	68.50%	25.70%	1.24%	0.00%	GTAGAA: 4.56%
VI/Aromatic	96	54.20%	44.80%	1.04%	0.00%	NA
Intermediate	90	73.30%	22.20%	0.00%	0.00%	GTAGAA: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0123927172	G -> A	LOC_Os01g42234.2	upstream_gene_variant ; 2519.0bp to feature; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0123927172	G -> A	LOC_Os01g42220.1	downstream_gene_variant ; 4310.0bp to feature; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0123927172	G -> A	LOC_Os01g42234.1	intron_variant ; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0123927172	G -> GTAGAA	LOC_Os01g42234.2	upstream_gene_variant ; 2518.0bp to feature; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0123927172	G -> GTAGAA	LOC_Os01g42220.1	downstream_gene_variant ; 4311.0bp to feature; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0123927172	G -> GTAGAA	LOC_Os01g42234.1	intron_variant ; MODIFIER	silent_mutation	Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0123927172	NA	4.72E-06	mr1127_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	4.42E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	3.08E-07	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	1.93E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	6.72E-06	mr1545_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	2.86E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	2.38E-09	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123927172	NA	1.45E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251