\
| Variant ID: vg0123927172 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 23927172 |
| Reference Allele: G | Alternative Allele: A,GTAGAA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTTACTGACCGAGCTATGTTAGGCGGTGTTTGGTTGGAGGGATTAAAGTGGTGCTAAACTTTAGTCCCTCTCACAAAAATATAAGTTCTTACCATAGG[G/A,GTAGAA]
ACTTATACTTTTGTGAGAGGGACTAAATTTAGTCCCTAGTTCCCAAACACCCCCTTAAAATGGTTACAGACAAAAAAAAATAAAATAAAAAAAGAAACAT
ATGTTTCTTTTTTTATTTTATTTTTTTTTGTCTGTAACCATTTTAAGGGGGTGTTTGGGAACTAGGGACTAAATTTAGTCCCTCTCACAAAAGTATAAGT[C/T,TTCTAC]
CCTATGGTAAGAACTTATATTTTTGTGAGAGGGACTAAAGTTTAGCACCACTTTAATCCCTCCAACCAAACACCGCCTAACATAGCTCGGTCAGTAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 27.70% | 1.16% | 0.00% | GTAGAA: 2.98% |
| All Indica | 2759 | 69.80% | 29.50% | 0.40% | 0.00% | GTAGAA: 0.25% |
| All Japonica | 1512 | 77.40% | 11.80% | 2.25% | 0.00% | GTAGAA: 8.60% |
| Aus | 269 | 2.60% | 94.10% | 3.35% | 0.00% | NA |
| Indica I | 595 | 40.70% | 58.80% | 0.50% | 0.00% | NA |
| Indica II | 465 | 88.40% | 11.00% | 0.00% | 0.00% | GTAGAA: 0.65% |
| Indica III | 913 | 76.00% | 23.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 73.80% | 24.80% | 0.89% | 0.00% | GTAGAA: 0.51% |
| Temperate Japonica | 767 | 98.80% | 0.80% | 0.00% | 0.00% | GTAGAA: 0.39% |
| Tropical Japonica | 504 | 49.00% | 21.80% | 6.15% | 0.00% | GTAGAA: 23.02% |
| Japonica Intermediate | 241 | 68.50% | 25.70% | 1.24% | 0.00% | GTAGAA: 4.56% |
| VI/Aromatic | 96 | 54.20% | 44.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 22.20% | 0.00% | 0.00% | GTAGAA: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123927172 | G -> A | LOC_Os01g42234.2 | upstream_gene_variant ; 2519.0bp to feature; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0123927172 | G -> A | LOC_Os01g42220.1 | downstream_gene_variant ; 4310.0bp to feature; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0123927172 | G -> A | LOC_Os01g42234.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0123927172 | G -> GTAGAA | LOC_Os01g42234.2 | upstream_gene_variant ; 2518.0bp to feature; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0123927172 | G -> GTAGAA | LOC_Os01g42220.1 | downstream_gene_variant ; 4311.0bp to feature; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0123927172 | G -> GTAGAA | LOC_Os01g42234.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.917; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123927172 | NA | 4.72E-06 | mr1127_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 4.42E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 3.08E-07 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 1.93E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 6.72E-06 | mr1545_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 2.86E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 2.38E-09 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123927172 | NA | 1.45E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |