\
| Variant ID: vg0123918111 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 23918111 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACTACTATGTTATAATCTAAATCAGCTATCTCAAAAATATTTTATCATAGGCACAGAGGAAAATGTTGACCCGAGTAAAGCAAGAGGCATAAAGGTTAA[A/G,T]
GAGAAAGCCATTCGTGGGTCGAGGAGACCAATTGGTGGTTTTGACAAGGCAACACAACGGAGTAAAAAGAAAAAGAGTGATTCAAACACATCAAAGTGTC
GACACTTTGATGTGTTTGAATCACTCTTTTTCTTTTTACTCCGTTGTGTTGCCTTGTCAAAACCACCAATTGGTCTCCTCGACCCACGAATGGCTTTCTC[T/C,A]
TTAACCTTTATGCCTCTTGCTTTACTCGGGTCAACATTTTCCTCTGTGCCTATGATAAAATATTTTTGAGATAGCTGATTTAGATTATAACATAGTAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.10% | 8.90% | 32.08% | 16.86% | T: 0.02% |
| All Indica | 2759 | 45.20% | 0.40% | 33.78% | 20.66% | T: 0.04% |
| All Japonica | 1512 | 43.70% | 26.30% | 18.72% | 11.38% | NA |
| Aus | 269 | 1.10% | 0.00% | 84.39% | 14.50% | NA |
| Indica I | 595 | 37.00% | 0.80% | 34.12% | 28.07% | NA |
| Indica II | 465 | 57.60% | 0.20% | 25.16% | 16.77% | T: 0.22% |
| Indica III | 913 | 45.60% | 0.20% | 37.90% | 16.32% | NA |
| Indica Intermediate | 786 | 43.50% | 0.30% | 33.84% | 22.39% | NA |
| Temperate Japonica | 767 | 49.00% | 41.20% | 9.26% | 0.52% | NA |
| Tropical Japonica | 504 | 41.50% | 3.20% | 31.15% | 24.21% | NA |
| Japonica Intermediate | 241 | 31.10% | 27.00% | 22.82% | 19.09% | NA |
| VI/Aromatic | 96 | 44.80% | 0.00% | 52.08% | 3.12% | NA |
| Intermediate | 90 | 43.30% | 15.60% | 26.67% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0123918111 | A -> G | LOC_Os01g42210.1 | upstream_gene_variant ; 1247.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> G | LOC_Os01g42220.1 | upstream_gene_variant ; 4233.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> G | LOC_Os01g42190.1 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> G | LOC_Os01g42200.1 | downstream_gene_variant ; 3216.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> G | LOC_Os01g42200-LOC_Os01g42210 | intergenic_region ; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> T | LOC_Os01g42210.1 | upstream_gene_variant ; 1247.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> T | LOC_Os01g42220.1 | upstream_gene_variant ; 4233.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> T | LOC_Os01g42190.1 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> T | LOC_Os01g42200.1 | downstream_gene_variant ; 3216.0bp to feature; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> T | LOC_Os01g42200-LOC_Os01g42210 | intergenic_region ; MODIFIER | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0123918111 | A -> DEL | N | N | silent_mutation | Average:24.404; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0123918111 | NA | 4.58E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 3.61E-06 | mr1070 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 4.46E-09 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 9.54E-06 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 7.73E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 3.69E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 8.17E-08 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 2.53E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 5.47E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | 2.22E-06 | 2.22E-06 | mr1797 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | 2.22E-06 | 2.22E-06 | mr1801 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | 4.32E-06 | 4.31E-06 | mr1824 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 1.07E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0123918111 | NA | 4.78E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |